EMAIL THIS PAGE TO A FRIEND

FAM13C

family with sequence similarity 13, member C

140 Gene Product Result for
Synonyms: FAM13C1
UniProtKB ID: Q8NE31, B7ZB77, Q5T631, Q6P2M3, Q99787
Gene ID:
Mouse(71721) family with sequence similarity 13, member C
Rat(294565) family with sequence similarity 13, member C
sheep(101119609) family with sequence similarity 13, member C
domestic guinea pig(100730005) family with sequence similarity 13, member C
naked mole-rat(101724014) family with sequence similarity 13, member C
chicken(423602) family with sequence similarity 13, member C
cow(540918) family with sequence similarity 13, member C
domestic cat(101097174) family with sequence similarity 13, member C
dog(488991) family with sequence similarity 13, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037888 Anti-FAM13C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV54376 Anti-FAM13C1 antibody produced in rabbit affinity isolated antibody rabbit, mouse, guinea pig, rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001971 Rosetta Predictions human pricing
NM_198215 Rosetta Predictions human pricing
XM_001080212 Rosetta Predictions rat pricing
XM_228362 Rosetta Predictions rat pricing
NM_024244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106596 predicted 560
2 SASI_Hs01_00106597 predicted 814
3 SASI_Hs01_00106598 predicted 1391
4 SASI_Hs02_00304049 predicted 1393
5 SASI_Hs01_00106600 predicted 193
6 SASI_Hs01_00106601 predicted 1359
7 SASI_Hs01_00106602 predicted 611
8 SASI_Hs01_00106603 predicted 1652
9 SASI_Hs01_00106604 predicted 1548
10 SASI_Hs01_00106605 predicted 1394
11 SASI_Hs01_00106599 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142044 predicted 555
2 SASI_Hs01_00142045 predicted 819
3 SASI_Hs01_00142046 predicted 1685
4 SASI_Hs02_00371746 predicted 1684
5 SASI_Hs01_00142048 predicted 196
6 SASI_Hs01_00142049 predicted 1656
7 SASI_Hs01_00142050 predicted 609
8 SASI_Hs01_00142051 predicted 1946
9 SASI_Hs01_00142052 predicted 1844
10 SASI_Hs01_00142053 predicted 1684
11 SASI_Hs01_00142047 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367088 predicted 822
2 SASI_Rn02_00367089 predicted 1995
3 SASI_Rn02_00367090 predicted 464
4 SASI_Rn02_00367091 predicted 2289
5 SASI_Rn02_00367092 predicted 1249
6 SASI_Rn02_00367093 predicted 889
7 SASI_Rn02_00367094 predicted 1309
8 SASI_Rn02_00367095 predicted 1745
9 SASI_Rn02_00367096 predicted 1419
10 SASI_Rn02_00367097 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385022 predicted 359
2 SASI_Rn02_00385023 predicted 240
3 SASI_Rn02_00385024 predicted 277
4 SASI_Rn02_00385025 predicted 287
5 SASI_Rn02_00385026 predicted 435
6 SASI_Rn02_00385027 predicted 356
7 SASI_Rn02_00385028 predicted 257
8 SASI_Rn02_00385029 predicted 194
9 SASI_Rn02_00385030 predicted 469
10 SASI_Rn02_00385031 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034189 predicted 1685
2 SASI_Mm01_00034190 predicted 511
3 SASI_Mm01_00034191 predicted 1991
4 SASI_Mm01_00034192 predicted 1980
5 SASI_Mm01_00034193 predicted 201
6 SASI_Mm01_00034194 predicted 580
7 SASI_Mm01_00034195 predicted 1731
8 SASI_Mm01_00034196 predicted 1111
9 SASI_Mm01_00034197 predicted 1101
10 SASI_Mm01_00034198 predicted 1795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024244
VALIDATED
FAM13C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member C
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-140s1c1
Sequence:CCGGGCTGTAACTGAGTGTGACGAACTCGAGTTCGTCACACTCAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-2686s1c1
Sequence:CCGGGCATCTTTCTTAATGTTCCAACTCGAGTTGGAACATTAAGAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-1120s1c1
Sequence:CCGGCGAAGTTCTGAAATGGATGAACTCGAGTTCATCCATTTCAGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024244.3-475s1c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1027s1c1
Sequence:CCGGCCAAAGCCTCAAGAGGAAGATCTCGAGATCTTCCTCTTGAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-3045s1c1
Sequence:CCGGGCTGTTTATGAATCAGAGTAACTCGAGTTACTCTGATTCATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1451s1c1
Sequence:CCGGCCATCCCTTATCCCAACAATTCTCGAGAATTGTTGGGATAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-512s1c1
Sequence:CCGGGTGCGACTTCAACCAAGAATACTCGAGTATTCTTGGTTGAAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024244.4-2211s21c1
Sequence:CCGGGCTACCTGCTAGCGAAGATTTCTCGAGAAATCTTCGCTAGCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1380s21c1
Sequence:CCGGGACGATGGGAAGGGAACTAAGCTCGAGCTTAGTTCCCTTCCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1748s21c1
Sequence:CCGGGCGAGAATTTGAAGAACAATTCTCGAGAATTGTTCTTCAAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024244.4-547s21c1
Sequence:CCGGTAGACCAGAGGGCTACCATTTCTCGAGAAATGGTAGCCCTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-491s21c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024244
VALIDATED
FAM13C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member C
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-140s1c1
Sequence:CCGGGCTGTAACTGAGTGTGACGAACTCGAGTTCGTCACACTCAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-2686s1c1
Sequence:CCGGGCATCTTTCTTAATGTTCCAACTCGAGTTGGAACATTAAGAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-1120s1c1
Sequence:CCGGCGAAGTTCTGAAATGGATGAACTCGAGTTCATCCATTTCAGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024244.3-475s1c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1027s1c1
Sequence:CCGGCCAAAGCCTCAAGAGGAAGATCTCGAGATCTTCCTCTTGAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-3045s1c1
Sequence:CCGGGCTGTTTATGAATCAGAGTAACTCGAGTTACTCTGATTCATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1451s1c1
Sequence:CCGGCCATCCCTTATCCCAACAATTCTCGAGAATTGTTGGGATAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-512s1c1
Sequence:CCGGGTGCGACTTCAACCAAGAATACTCGAGTATTCTTGGTTGAAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024244.4-2211s21c1
Sequence:CCGGGCTACCTGCTAGCGAAGATTTCTCGAGAAATCTTCGCTAGCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1380s21c1
Sequence:CCGGGACGATGGGAAGGGAACTAAGCTCGAGCTTAGTTCCCTTCCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1748s21c1
Sequence:CCGGGCGAGAATTTGAAGAACAATTCTCGAGAATTGTTCTTCAAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024244.4-547s21c1
Sequence:CCGGTAGACCAGAGGGCTACCATTTCTCGAGAAATGGTAGCCCTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-491s21c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024244
VALIDATED
FAM13C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member C
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-140s1c1
Sequence:CCGGGCTGTAACTGAGTGTGACGAACTCGAGTTCGTCACACTCAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-2686s1c1
Sequence:CCGGGCATCTTTCTTAATGTTCCAACTCGAGTTGGAACATTAAGAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024244.3-1120s1c1
Sequence:CCGGCGAAGTTCTGAAATGGATGAACTCGAGTTCATCCATTTCAGAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024244.3-475s1c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1027s1c1
Sequence:CCGGCCAAAGCCTCAAGAGGAAGATCTCGAGATCTTCCTCTTGAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024244.3-3045s1c1
Sequence:CCGGGCTGTTTATGAATCAGAGTAACTCGAGTTACTCTGATTCATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-1451s1c1
Sequence:CCGGCCATCCCTTATCCCAACAATTCTCGAGAATTGTTGGGATAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024244.3-512s1c1
Sequence:CCGGGTGCGACTTCAACCAAGAATACTCGAGTATTCTTGGTTGAAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024244.4-2211s21c1
Sequence:CCGGGCTACCTGCTAGCGAAGATTTCTCGAGAAATCTTCGCTAGCAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1380s21c1
Sequence:CCGGGACGATGGGAAGGGAACTAAGCTCGAGCTTAGTTCCCTTCCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-1748s21c1
Sequence:CCGGGCGAGAATTTGAAGAACAATTCTCGAGAATTGTTCTTCAAATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024244.4-547s21c1
Sequence:CCGGTAGACCAGAGGGCTACCATTTCTCGAGAAATGGTAGCCCTCTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024244.4-491s21c1
Sequence:CCGGGAGTCCACAAAGCAGCATCTTCTCGAGAAGATGCTGCTTTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198215
FAM13C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198215.1-1360s1c1
Sequence:CCGGCGCTTTATGACCGATACAGAACTCGAGTTCTGTATCGGTCATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1041s1c1
Sequence:CCGGCATGGTGACAAGACTTCTAATCTCGAGATTAGAAGTCTTGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1404s1c1
Sequence:CCGGCCTTCCCTTATTCCAACAATTCTCGAGAATTGTTGGAATAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-362s1c1
Sequence:CCGGGAAGCCCAAGTCCATCTTCAACTCGAGTTGAAGATGGACTTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1346s1c1
Sequence:CCGGGAACCTCATAAAGCCGCTTTACTCGAGTAAAGCGGCTTTATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1128s21c1
Sequence:CCGGGATTTGGCTAAAGGTCGTAAACTCGAGTTTACGACCTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2334s21c1
Sequence:CCGGGCTAGCAAGAAAGCAATTTATCTCGAGATAAATTGCTTTCTTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1359s21c1
Sequence:CCGGGAGGATTCTAAGGTAACTAAGCTCGAGCTTAGTTACCTTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1676s21c1
Sequence:CCGGTCTTGACCATCTCCGAGAAACCTCGAGGTTTCTCGGAGATGGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2080s21c1
Sequence:CCGGATACAACAGGTAGCCATATAACTCGAGTTATATGGCTACCTGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198215
FAM13C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198215.1-1360s1c1
Sequence:CCGGCGCTTTATGACCGATACAGAACTCGAGTTCTGTATCGGTCATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1041s1c1
Sequence:CCGGCATGGTGACAAGACTTCTAATCTCGAGATTAGAAGTCTTGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1404s1c1
Sequence:CCGGCCTTCCCTTATTCCAACAATTCTCGAGAATTGTTGGAATAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-362s1c1
Sequence:CCGGGAAGCCCAAGTCCATCTTCAACTCGAGTTGAAGATGGACTTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1346s1c1
Sequence:CCGGGAACCTCATAAAGCCGCTTTACTCGAGTAAAGCGGCTTTATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1128s21c1
Sequence:CCGGGATTTGGCTAAAGGTCGTAAACTCGAGTTTACGACCTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2334s21c1
Sequence:CCGGGCTAGCAAGAAAGCAATTTATCTCGAGATAAATTGCTTTCTTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1359s21c1
Sequence:CCGGGAGGATTCTAAGGTAACTAAGCTCGAGCTTAGTTACCTTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1676s21c1
Sequence:CCGGTCTTGACCATCTCCGAGAAACCTCGAGGTTTCTCGGAGATGGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2080s21c1
Sequence:CCGGATACAACAGGTAGCCATATAACTCGAGTTATATGGCTACCTGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198215
FAM13C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198215.1-1360s1c1
Sequence:CCGGCGCTTTATGACCGATACAGAACTCGAGTTCTGTATCGGTCATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1041s1c1
Sequence:CCGGCATGGTGACAAGACTTCTAATCTCGAGATTAGAAGTCTTGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1404s1c1
Sequence:CCGGCCTTCCCTTATTCCAACAATTCTCGAGAATTGTTGGAATAAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-362s1c1
Sequence:CCGGGAAGCCCAAGTCCATCTTCAACTCGAGTTGAAGATGGACTTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198215.1-1346s1c1
Sequence:CCGGGAACCTCATAAAGCCGCTTTACTCGAGTAAAGCGGCTTTATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1128s21c1
Sequence:CCGGGATTTGGCTAAAGGTCGTAAACTCGAGTTTACGACCTTTAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2334s21c1
Sequence:CCGGGCTAGCAAGAAAGCAATTTATCTCGAGATAAATTGCTTTCTTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1359s21c1
Sequence:CCGGGAGGATTCTAAGGTAACTAAGCTCGAGCTTAGTTACCTTAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198215.3-1676s21c1
Sequence:CCGGTCTTGACCATCTCCGAGAAACCTCGAGGTTTCTCGGAGATGGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198215.3-2080s21c1
Sequence:CCGGATACAACAGGTAGCCATATAACTCGAGTTATATGGCTACCTGTTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks