EMAIL THIS PAGE TO A FRIEND

FAM149A

family with sequence similarity 149, member A

62 Gene Product Result for
Synonyms: MSTP119
UniProtKB ID: A5PLN7, B5MDB8, Q2TAN6, Q7Z2S5, Q9Y4T9
Gene ID:
Mouse(212326) family with sequence similarity 149, member A
Rat(361153) family with sequence similarity 149, member A
chicken(422721) family with sequence similarity 149, member A
cow(512887) family with sequence similarity 149, member A
domestic cat(101097312) family with sequence similarity 149, member A
dog(475625) family with sequence similarity 149, member A
naked mole-rat(101714297) family with sequence similarity 149, member A
domestic guinea pig(100716360) family with sequence similarity 149, member A
sheep(101115854) family with sequence similarity 149, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006655 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092151 MISSION® esiRNA esiRNA human FAM149A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006655 Rosetta Predictions human pricing
NM_015398 Rosetta Predictions human pricing
XM_001061521 Rosetta Predictions rat pricing
XM_341438 Rosetta Predictions rat pricing
NM_153535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178505 predicted 786
2 SASI_Hs01_00178506 predicted 1606
3 SASI_Hs01_00178507 predicted 1033
4 SASI_Hs01_00178508 predicted 1250
5 SASI_Hs01_00178509 predicted 498
6 SASI_Hs01_00178510 predicted 708
7 SASI_Hs01_00178511 predicted 1430
8 SASI_Hs01_00178512 predicted 487
9 SASI_Hs01_00178513 predicted 354
10 SASI_Hs01_00178514 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161205 predicted 1086
2 SASI_Hs01_00161206 predicted 1910
3 SASI_Hs01_00161207 predicted 1329
4 SASI_Hs01_00161208 predicted 1555
5 SASI_Hs01_00161209 predicted 791
6 SASI_Hs01_00161210 predicted 1011
7 SASI_Hs01_00161211 predicted 1729
8 SASI_Hs01_00161212 predicted 784
9 SASI_Hs01_00161213 predicted 653
10 SASI_Hs01_00161214 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300367 predicted 1939
2 SASI_Rn02_00300368 predicted 932
3 SASI_Rn02_00300369 predicted 1923
4 SASI_Rn02_00300370 predicted 999
5 SASI_Rn02_00300371 predicted 1683
6 SASI_Rn02_00300372 predicted 2248
7 SASI_Rn02_00300373 predicted 1013
8 SASI_Rn02_00300374 predicted 2367
9 SASI_Rn02_00300375 predicted 1520
10 SASI_Rn02_00300376 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392922 predicted 1937
2 SASI_Rn02_00392923 predicted 1930
3 SASI_Rn02_00392924 predicted 1739
4 SASI_Rn02_00392925 predicted 1682
5 SASI_Rn02_00392926 predicted 2247
6 SASI_Rn02_00392927 predicted 2368
7 SASI_Rn02_00392928 predicted 1515
8 SASI_Rn02_00392929 predicted 2346
9 SASI_Rn02_00392930 predicted 1813
10 SASI_Rn02_00392931 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106483 predicted 2686
2 SASI_Mm01_00106484 predicted 1404
3 SASI_Mm01_00106485 predicted 2679
4 SASI_Mm01_00106486 predicted 1825
5 SASI_Mm01_00106487 predicted 1895
6 SASI_Mm01_00106489 predicted 1587
7 SASI_Mm01_00106490 predicted 2882
8 SASI_Mm01_00106491 predicted 2782
9 SASI_Mm02_00343299 predicted 2901
10 SASI_Mm02_00343300 predicted 1550
11 SASI_Mm01_00106482 predicted 2627
12 SASI_Mm01_00106488 predicted 1859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153535
FAM149A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 149, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-1560s1c1
Sequence:CCGGCGATGAAGGCTTCCAACATTTCTCGAGAAATGTTGGAAGCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-2827s1c1
Sequence:CCGGCAGTATCTGCCCAAATCTTATCTCGAGATAAGATTTGGGCAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.1-2750s1c1
Sequence:CCGGCCTGACTGCAAGAAAGAGGTTCTCGAGAACCTCTTTCTTGCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153535.1-2901s1c1
Sequence:CCGGGCAATAGGAGACGGCAGAATACTCGAGTATTCTGCCGTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1656s1c1
Sequence:CCGGGAAGAGGTGTACCATGTGGATCTCGAGATCCACATGGTACACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1794s1c1
Sequence:CCGGCCTGATGACTGCATCAGAGATCTCGAGATCTCTGATGCAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153535.1-2864s1c1
Sequence:CCGGGAACAAGTACTAACTGGAATACTCGAGTATTCCAGTTAGTACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-2341s1c1
Sequence:CCGGCCACTGTCTACAGTGATGAAACTCGAGTTTCATCACTGTAGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153535
FAM149A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 149, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-1560s1c1
Sequence:CCGGCGATGAAGGCTTCCAACATTTCTCGAGAAATGTTGGAAGCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-2827s1c1
Sequence:CCGGCAGTATCTGCCCAAATCTTATCTCGAGATAAGATTTGGGCAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.1-2750s1c1
Sequence:CCGGCCTGACTGCAAGAAAGAGGTTCTCGAGAACCTCTTTCTTGCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153535.1-2901s1c1
Sequence:CCGGGCAATAGGAGACGGCAGAATACTCGAGTATTCTGCCGTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1656s1c1
Sequence:CCGGGAAGAGGTGTACCATGTGGATCTCGAGATCCACATGGTACACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1794s1c1
Sequence:CCGGCCTGATGACTGCATCAGAGATCTCGAGATCTCTGATGCAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153535.1-2864s1c1
Sequence:CCGGGAACAAGTACTAACTGGAATACTCGAGTATTCCAGTTAGTACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-2341s1c1
Sequence:CCGGCCACTGTCTACAGTGATGAAACTCGAGTTTCATCACTGTAGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153535
FAM149A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 149, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-1560s1c1
Sequence:CCGGCGATGAAGGCTTCCAACATTTCTCGAGAAATGTTGGAAGCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.2-2827s1c1
Sequence:CCGGCAGTATCTGCCCAAATCTTATCTCGAGATAAGATTTGGGCAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153535.1-2750s1c1
Sequence:CCGGCCTGACTGCAAGAAAGAGGTTCTCGAGAACCTCTTTCTTGCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153535.1-2901s1c1
Sequence:CCGGGCAATAGGAGACGGCAGAATACTCGAGTATTCTGCCGTCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1656s1c1
Sequence:CCGGGAAGAGGTGTACCATGTGGATCTCGAGATCCACATGGTACACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-1794s1c1
Sequence:CCGGCCTGATGACTGCATCAGAGATCTCGAGATCTCTGATGCAGTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153535.1-2864s1c1
Sequence:CCGGGAACAAGTACTAACTGGAATACTCGAGTATTCCAGTTAGTACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153535.1-2341s1c1
Sequence:CCGGCCACTGTCTACAGTGATGAAACTCGAGTTTCATCACTGTAGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006655
FAM149A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 149, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1327s1c1
Sequence:CCGGGCAGAATGAGAAGGAGGACAACTCGAGTTGTCCTCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1472s1c1
Sequence:CCGGGCTTCAGATTCACAGAGACTACTCGAGTAGTCTCTGTGAATCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-818s1c1
Sequence:CCGGGAAGAGGTTTACCATGTGGATCTCGAGATCCACATGGTAAACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1655s1c1
Sequence:CCGGGTTTCTTACAGAGGAAGGCATCTCGAGATGCCTTCCTCTGTAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1404s1c1
Sequence:CCGGCCTCAGACACTCATGGATTATCTCGAGATAATCCATGAGTGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006655
FAM149A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 149, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1327s1c1
Sequence:CCGGGCAGAATGAGAAGGAGGACAACTCGAGTTGTCCTCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1472s1c1
Sequence:CCGGGCTTCAGATTCACAGAGACTACTCGAGTAGTCTCTGTGAATCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-818s1c1
Sequence:CCGGGAAGAGGTTTACCATGTGGATCTCGAGATCCACATGGTAAACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1655s1c1
Sequence:CCGGGTTTCTTACAGAGGAAGGCATCTCGAGATGCCTTCCTCTGTAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1404s1c1
Sequence:CCGGCCTCAGACACTCATGGATTATCTCGAGATAATCCATGAGTGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006655
FAM149A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 149, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1327s1c1
Sequence:CCGGGCAGAATGAGAAGGAGGACAACTCGAGTTGTCCTCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1472s1c1
Sequence:CCGGGCTTCAGATTCACAGAGACTACTCGAGTAGTCTCTGTGAATCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-818s1c1
Sequence:CCGGGAAGAGGTTTACCATGTGGATCTCGAGATCCACATGGTAAACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1655s1c1
Sequence:CCGGGTTTCTTACAGAGGAAGGCATCTCGAGATGCCTTCCTCTGTAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006655.1-1404s1c1
Sequence:CCGGCCTCAGACACTCATGGATTATCTCGAGATAATCCATGAGTGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks