EMAIL THIS PAGE TO A FRIEND

FAM149B1

family with sequence similarity 149, member B1

95 Gene Product Result for
Synonyms: KIAA0974
UniProtKB ID: Q96BN6, Q9Y2I0
Gene ID:
Rat(289900) family with sequence similarity 149, member B1
sheep(101117643) family with sequence similarity 149, member B1
domestic guinea pig(100717575) family with sequence similarity 149, member B1
naked mole-rat(101724531) family with sequence similarity 149, member B1
chicken(423639) family with sequence similarity 149, member B1
dog(609882) family with sequence similarity 149, member B1
cow(533952) family with sequence similarity 149, member B1
domestic cat(101097098) family with sequence similarity 149, member B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173348 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148411 MISSION® esiRNA esiRNA human FAM149B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013878 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201145 predicted 323
2 SASI_Rn01_00106469 predicted 219
3 SASI_Rn01_00106470 predicted 981
4 SASI_Rn01_00106471 predicted 1273
5 SASI_Rn01_00106472 predicted 982
6 SASI_Rn01_00106473 predicted 219
7 SASI_Rn01_00106474 predicted 1471
8 SASI_Rn01_00106476 predicted 947
9 SASI_Rn02_00201146 predicted 1097
10 SASI_Rn02_00201147 predicted 985
11 SASI_Rn01_00106467 predicted 916
12 SASI_Rn01_00106468 predicted 796
13 SASI_Rn01_00106475 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173348
VALIDATED
FAM149B1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 149, member B1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1390s21c1
Sequence:CCGGCCATCCTTTCAACTCGAAATTCTCGAGAATTTCGAGTTGAAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173348.1-668s21c1
Sequence:CCGGCACTCCAAGTGAAGGTTATAGCTCGAGCTATAACCTTCACTTGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173348.1-2476s21c1
Sequence:CCGGCTACCCTATCAGCAGATTAAACTCGAGTTTAATCTGCTGATAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-794s21c1
Sequence:CCGGTTCATCTTCTTATGCTCATAACTCGAGTTATGAGCATAAGAAGATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1800s21c1
Sequence:CCGGCCCAACACAACTCAATCATTTCTCGAGAAATGATTGAGTTGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173348
VALIDATED
FAM149B1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 149, member B1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1390s21c1
Sequence:CCGGCCATCCTTTCAACTCGAAATTCTCGAGAATTTCGAGTTGAAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173348.1-668s21c1
Sequence:CCGGCACTCCAAGTGAAGGTTATAGCTCGAGCTATAACCTTCACTTGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173348.1-2476s21c1
Sequence:CCGGCTACCCTATCAGCAGATTAAACTCGAGTTTAATCTGCTGATAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-794s21c1
Sequence:CCGGTTCATCTTCTTATGCTCATAACTCGAGTTATGAGCATAAGAAGATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1800s21c1
Sequence:CCGGCCCAACACAACTCAATCATTTCTCGAGAAATGATTGAGTTGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173348
VALIDATED
FAM149B1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 149, member B1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1390s21c1
Sequence:CCGGCCATCCTTTCAACTCGAAATTCTCGAGAATTTCGAGTTGAAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173348.1-668s21c1
Sequence:CCGGCACTCCAAGTGAAGGTTATAGCTCGAGCTATAACCTTCACTTGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173348.1-2476s21c1
Sequence:CCGGCTACCCTATCAGCAGATTAAACTCGAGTTTAATCTGCTGATAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-794s21c1
Sequence:CCGGTTCATCTTCTTATGCTCATAACTCGAGTTATGAGCATAAGAAGATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173348.1-1800s21c1
Sequence:CCGGCCCAACACAACTCAATCATTTCTCGAGAAATGATTGAGTTGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)