EMAIL THIS PAGE TO A FRIEND

FAM150A

family with sequence similarity 150, member A

54 Gene Product Result for
Synonyms: UNQ9433
UniProtKB ID: Q6UXT8
Gene ID:
Mouse(620393) family with sequence similarity 150, member A
Rat(681161) family with sequence similarity 150, member A
chicken(100859887) family with sequence similarity 150, member A
cow(100297122) family with sequence similarity 150, member A
domestic cat(101094234) family with sequence similarity 150, member A
naked mole-rat(101713529) family with sequence similarity 150, member A
domestic guinea pig(101789066) family with sequence similarity 150, member A
sheep(101106950) family with sequence similarity 150, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207413 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058121 MISSION® esiRNA esiRNA human FAM150A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207413 Rosetta Predictions human pricing
XM_001060559 Rosetta Predictions rat pricing
XM_973835 Rosetta Predictions mouse pricing
XM_975315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144037 predicted 738
2 SASI_Hs01_00144038 predicted 601
3 SASI_Hs01_00144040 predicted 693
4 SASI_Hs01_00144041 predicted 689
5 SASI_Hs01_00144042 predicted 618
6 SASI_Hs01_00144043 predicted 615
7 SASI_Hs01_00144044 predicted 742
8 SASI_Hs02_00374046 predicted 756
9 SASI_Hs01_00144045 predicted 601
10 SASI_Hs01_00144046 predicted 719
11 SASI_Hs01_00144039 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297012 predicted 326
2 SASI_Rn02_00297013 predicted 189
3 SASI_Rn02_00297014 predicted 226
4 SASI_Rn02_00297015 predicted 258
5 SASI_Rn02_00297016 predicted 203
6 SASI_Rn02_00297017 predicted 262
7 SASI_Rn02_00297018 predicted 273
8 SASI_Rn02_00297019 predicted 250
9 SASI_Rn02_00297020 predicted 271
10 SASI_Rn02_00297021 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236842 predicted 555
2 SASI_Mm01_00236843 predicted 597
3 SASI_Mm01_00236844 predicted 538
4 SASI_Mm01_00236845 predicted 547
5 SASI_Mm01_00236846 predicted 547
6 SASI_Mm01_00236847 predicted 605
7 SASI_Mm01_00236848 predicted 597
8 SASI_Mm01_00236849 predicted 581
9 SASI_Mm01_00236850 predicted 564
10 SASI_Mm01_00236851 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445614 predicted 468
2 SASI_Mm02_00445615 predicted 405
3 SASI_Mm02_00445616 predicted 726
4 SASI_Mm02_00445617 predicted 478
5 SASI_Mm02_00445618 predicted 490
6 SASI_Mm02_00445619 predicted 546
7 SASI_Mm02_00445620 predicted 513
8 SASI_Mm02_00445621 predicted 763
9 SASI_Mm02_00445622 predicted 479
10 SASI_Mm02_00445623 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207413
FAM150A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 150, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-398s1c1
Sequence:CCGGGAAATATTCCCAAGAGACTCTCTCGAGAGAGTCTCTTGGGAATATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-604s1c1
Sequence:CCGGCTACCCTACATTTCCTAAGAACTCGAGTTCTTAGGAAATGTAGGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-725s1c1
Sequence:CCGGCTTCCCAGAAATAACTGGTTACTCGAGTAACCAGTTATTTCTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-481s1c1
Sequence:CCGGCAAACATTTCCACCGACTCTACTCGAGTAGAGTCGGTGGAAATGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-394s1c1
Sequence:CCGGCGCAGAAATATTCCCAAGAGACTCGAGTCTCTTGGGAATATTTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-478s1c1
Sequence:CCGGCAGCAAACATTTCCACCGACTCTCGAGAGTCGGTGGAAATGTTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-561s1c1
Sequence:CCGGCAAGATTAGCAGTGAGTCCACCTCGAGGTGGACTCACTGCTAATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-519s1c1
Sequence:CCGGGCTCAACGCCAGCTTATTACACTCGAGTGTAATAAGCTGGCGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-391s1c1
Sequence:CCGGGAGCGCAGAAATATTCCCAAGCTCGAGCTTGGGAATATTTCTGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-406s1c1
Sequence:CCGGCCCAAGAGACTCTAACTTAAACTCGAGTTTAAGTTAGAGTCTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207413
FAM150A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 150, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-398s1c1
Sequence:CCGGGAAATATTCCCAAGAGACTCTCTCGAGAGAGTCTCTTGGGAATATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-604s1c1
Sequence:CCGGCTACCCTACATTTCCTAAGAACTCGAGTTCTTAGGAAATGTAGGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-725s1c1
Sequence:CCGGCTTCCCAGAAATAACTGGTTACTCGAGTAACCAGTTATTTCTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-481s1c1
Sequence:CCGGCAAACATTTCCACCGACTCTACTCGAGTAGAGTCGGTGGAAATGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-394s1c1
Sequence:CCGGCGCAGAAATATTCCCAAGAGACTCGAGTCTCTTGGGAATATTTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-478s1c1
Sequence:CCGGCAGCAAACATTTCCACCGACTCTCGAGAGTCGGTGGAAATGTTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-561s1c1
Sequence:CCGGCAAGATTAGCAGTGAGTCCACCTCGAGGTGGACTCACTGCTAATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-519s1c1
Sequence:CCGGGCTCAACGCCAGCTTATTACACTCGAGTGTAATAAGCTGGCGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-391s1c1
Sequence:CCGGGAGCGCAGAAATATTCCCAAGCTCGAGCTTGGGAATATTTCTGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-406s1c1
Sequence:CCGGCCCAAGAGACTCTAACTTAAACTCGAGTTTAAGTTAGAGTCTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207413
FAM150A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 150, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-398s1c1
Sequence:CCGGGAAATATTCCCAAGAGACTCTCTCGAGAGAGTCTCTTGGGAATATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-604s1c1
Sequence:CCGGCTACCCTACATTTCCTAAGAACTCGAGTTCTTAGGAAATGTAGGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207413.1-725s1c1
Sequence:CCGGCTTCCCAGAAATAACTGGTTACTCGAGTAACCAGTTATTTCTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-481s1c1
Sequence:CCGGCAAACATTTCCACCGACTCTACTCGAGTAGAGTCGGTGGAAATGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-394s1c1
Sequence:CCGGCGCAGAAATATTCCCAAGAGACTCGAGTCTCTTGGGAATATTTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-478s1c1
Sequence:CCGGCAGCAAACATTTCCACCGACTCTCGAGAGTCGGTGGAAATGTTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-561s1c1
Sequence:CCGGCAAGATTAGCAGTGAGTCCACCTCGAGGTGGACTCACTGCTAATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-519s1c1
Sequence:CCGGGCTCAACGCCAGCTTATTACACTCGAGTGTAATAAGCTGGCGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207413.1-391s1c1
Sequence:CCGGGAGCGCAGAAATATTCCCAAGCTCGAGCTTGGGAATATTTCTGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207413.1-406s1c1
Sequence:CCGGCCCAAGAGACTCTAACTTAAACTCGAGTTTAAGTTAGAGTCTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)