EMAIL THIS PAGE TO A FRIEND

FAM150B

family with sequence similarity 150, member B

41 Gene Product Result for
Synonyms: PRO1097 RGPG542
UniProtKB ID: Q6UX46, B5MC76
Gene ID:
Mouse(100294583) family with sequence similarity 150, member B
Rat(679566) family with sequence similarity 150, member B
sheep(101112199) family with sequence similarity 150, member B
domestic guinea pig(100723426) family with sequence similarity 150, member B
naked mole-rat(101704676) family with sequence similarity 150, member B
chicken(421910) family with sequence similarity 150, member B
cow(616690) family with sequence similarity 150, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002919 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002919 Rosetta Predictions human pricing
NM_001109372 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304268 predicted 723
2 SASI_Hs02_00304269 predicted 644
3 SASI_Hs01_00115315 predicted 768
4 SASI_Hs02_00304270 predicted 718
5 SASI_Hs02_00304271 predicted 685
6 SASI_Hs02_00304272 predicted 649
7 SASI_Hs02_00304273 predicted 643
8 SASI_Hs02_00304274 predicted 721
9 SASI_Hs02_00304275 predicted 727
10 SASI_Hs02_00304276 predicted 693
11 SASI_Hs01_00115316 predicted 252
12 SASI_Hs01_00115317 predicted 253
13 SASI_Hs01_00115318 predicted 227
14 SASI_Hs01_00115319 predicted 274
15 SASI_Hs01_00115320 predicted 224
16 SASI_Hs01_00115321 predicted 273
17 SASI_Hs01_00115322 predicted 229
18 SASI_Hs01_00115323 predicted 249
19 SASI_Hs01_00115324 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247776 predicted 1044
2 SASI_Rn02_00247777 predicted 1197
3 SASI_Rn02_00247778 predicted 1064
4 SASI_Rn02_00247779 predicted 1034
5 SASI_Rn02_00247780 predicted 1074
6 SASI_Rn02_00247781 predicted 708
7 SASI_Rn02_00247782 predicted 1176
8 SASI_Rn02_00247783 predicted 1112
9 SASI_Rn02_00247784 predicted 739
10 SASI_Rn02_00247785 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002919
FAM150B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 150, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-66s1c1
Sequence:CCGGCAGCGAGTGGAAATTGTTCCTCTCGAGAGGAACAATTTCCACTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-330s1c1
Sequence:CCGGCCAACAGGGAAACAGAACTATCTCGAGATAGTTCTGTTTCCCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-98s1c1
Sequence:CCGGGATGAAGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-158s1c1
Sequence:CCGGCAAACACTTCCATAGACTTTACTCGAGTAAAGTCTATGGAAGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-157s1c1
Sequence:CCGGGCAAACACTTCCATAGACTTTCTCGAGAAAGTCTATGGAAGTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-122s1c1
Sequence:CCGGCCTTACAGGCCCTCTTTATTTCTCGAGAAATAAAGAGGGCCTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002919.2-1061s21c1
Sequence:CCGGTTTGACGTGTAGTGCTATAAACTCGAGTTTATAGCACTACACGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002919.2-729s21c1
Sequence:CCGGACCATTCCTGCATACTATAAACTCGAGTTTATAGTATGCAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002919
FAM150B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 150, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-66s1c1
Sequence:CCGGCAGCGAGTGGAAATTGTTCCTCTCGAGAGGAACAATTTCCACTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-330s1c1
Sequence:CCGGCCAACAGGGAAACAGAACTATCTCGAGATAGTTCTGTTTCCCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-98s1c1
Sequence:CCGGGATGAAGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-158s1c1
Sequence:CCGGCAAACACTTCCATAGACTTTACTCGAGTAAAGTCTATGGAAGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-157s1c1
Sequence:CCGGGCAAACACTTCCATAGACTTTCTCGAGAAAGTCTATGGAAGTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-122s1c1
Sequence:CCGGCCTTACAGGCCCTCTTTATTTCTCGAGAAATAAAGAGGGCCTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002919.2-1061s21c1
Sequence:CCGGTTTGACGTGTAGTGCTATAAACTCGAGTTTATAGCACTACACGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002919.2-729s21c1
Sequence:CCGGACCATTCCTGCATACTATAAACTCGAGTTTATAGTATGCAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002919
FAM150B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 150, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-66s1c1
Sequence:CCGGCAGCGAGTGGAAATTGTTCCTCTCGAGAGGAACAATTTCCACTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-330s1c1
Sequence:CCGGCCAACAGGGAAACAGAACTATCTCGAGATAGTTCTGTTTCCCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-98s1c1
Sequence:CCGGGATGAAGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-158s1c1
Sequence:CCGGCAAACACTTCCATAGACTTTACTCGAGTAAAGTCTATGGAAGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-157s1c1
Sequence:CCGGGCAAACACTTCCATAGACTTTCTCGAGAAAGTCTATGGAAGTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002919.1-122s1c1
Sequence:CCGGCCTTACAGGCCCTCTTTATTTCTCGAGAAATAAAGAGGGCCTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002919.2-1061s21c1
Sequence:CCGGTTTGACGTGTAGTGCTATAAACTCGAGTTTATAGCACTACACGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002919.2-729s21c1
Sequence:CCGGACCATTCCTGCATACTATAAACTCGAGTTTATAGTATGCAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)