EMAIL THIS PAGE TO A FRIEND

FAM151A

family with sequence similarity 151, member A

53 Gene Product Result for
Synonyms: C1orf179
UniProtKB ID: Q8WW52, Q5VUG5, Q6DKH5, Q6UWV0, Q8NAX9, Q96KY5
Gene ID:
Mouse(230579) family with sequence simliarity 151, member A
Rat(313430) family with sequence similarity 151, member A
Zebrafish(100005645) family with sequence similarity 151, member A
cow(615989) family with sequence similarity 151, member A
domestic cat(101094281) family with sequence similarity 151, member A
dog(489575) family with sequence similarity 151, member A
naked mole-rat(101698653) family with sequence similarity 151, member A
domestic guinea pig(100733479) family with sequence similarity 151, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176782 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092171 MISSION® esiRNA esiRNA human FAM151A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176782 Rosetta Predictions human pricing
NM_001005558 Rosetta Predictions rat pricing
NM_146149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047610 predicted 1275
2 SASI_Hs01_00047611 predicted 1218
3 SASI_Hs01_00047612 predicted 669
4 SASI_Hs01_00047613 predicted 1067
5 SASI_Hs01_00047614 predicted 848
6 SASI_Hs01_00047615 predicted 1637
7 SASI_Hs01_00047616 predicted 451
8 SASI_Hs01_00047617 predicted 1060
9 SASI_Hs02_00369208 predicted 1006
10 SASI_Hs01_00047618 predicted 979
11 SASI_Hs01_00047619 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098038 predicted 1105
2 SASI_Rn01_00098039 predicted 548
3 SASI_Rn01_00098040 predicted 397
4 SASI_Rn01_00098041 predicted 471
5 SASI_Rn02_00198419 predicted 450
6 SASI_Rn01_00098042 predicted 310
7 SASI_Rn01_00098043 predicted 442
8 SASI_Rn01_00098045 predicted 578
9 SASI_Rn01_00098047 predicted 288
10 SASI_Rn02_00198420 predicted 1604
11 SASI_Rn01_00098044 predicted 598
12 SASI_Rn01_00098046 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164101 predicted 484
2 SASI_Mm02_00341835 predicted 472
3 SASI_Mm01_00164102 predicted 668
4 SASI_Mm01_00164103 predicted 465
5 SASI_Mm01_00164104 predicted 330
6 SASI_Mm01_00164105 predicted 920
7 SASI_Mm01_00164106 predicted 1340
8 SASI_Mm01_00164107 predicted 598
9 SASI_Mm01_00164108 predicted 1330
10 SASI_Mm01_00164109 predicted 447
11 SASI_Mm01_00164110 predicted 1120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146149
FAM151A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 151, member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-319s21c1
Sequence:CCGGACAGCGATGTCATGGTCTTAGCTCGAGCTAAGACCATGACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-175s21c1
Sequence:CCGGGCTGTGAGAACGATGCAATTTCTCGAGAAATTGCATCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-559s21c1
Sequence:CCGGGGAGACCAGTGTGGATCAATGCTCGAGCATTGATCCACACTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-377s21c1
Sequence:CCGGTGAGACCAAGGTGCCCATTATCTCGAGATAATGGGCACCTTGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-463s21c1
Sequence:CCGGCATCTCAGAAGGGCATCAAACCTCGAGGTTTGATGCCCTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-606s1c1
Sequence:CCGGCCCATCTCAATTGAGATCAATCTCGAGATTGATCTCAATTGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-186s1c1
Sequence:CCGGGATGCAATTTGCGGTCCTGATCTCGAGATCAGGACCGCAAATTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146149
FAM151A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 151, member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-319s21c1
Sequence:CCGGACAGCGATGTCATGGTCTTAGCTCGAGCTAAGACCATGACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-175s21c1
Sequence:CCGGGCTGTGAGAACGATGCAATTTCTCGAGAAATTGCATCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-559s21c1
Sequence:CCGGGGAGACCAGTGTGGATCAATGCTCGAGCATTGATCCACACTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-377s21c1
Sequence:CCGGTGAGACCAAGGTGCCCATTATCTCGAGATAATGGGCACCTTGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-463s21c1
Sequence:CCGGCATCTCAGAAGGGCATCAAACCTCGAGGTTTGATGCCCTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-606s1c1
Sequence:CCGGCCCATCTCAATTGAGATCAATCTCGAGATTGATCTCAATTGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-186s1c1
Sequence:CCGGGATGCAATTTGCGGTCCTGATCTCGAGATCAGGACCGCAAATTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146149
FAM151A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 151, member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-319s21c1
Sequence:CCGGACAGCGATGTCATGGTCTTAGCTCGAGCTAAGACCATGACATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-175s21c1
Sequence:CCGGGCTGTGAGAACGATGCAATTTCTCGAGAAATTGCATCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-559s21c1
Sequence:CCGGGGAGACCAGTGTGGATCAATGCTCGAGCATTGATCCACACTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-377s21c1
Sequence:CCGGTGAGACCAAGGTGCCCATTATCTCGAGATAATGGGCACCTTGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146149.1-463s21c1
Sequence:CCGGCATCTCAGAAGGGCATCAAACCTCGAGGTTTGATGCCCTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-606s1c1
Sequence:CCGGCCCATCTCAATTGAGATCAATCTCGAGATTGATCTCAATTGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146149.1-186s1c1
Sequence:CCGGGATGCAATTTGCGGTCCTGATCTCGAGATCAGGACCGCAAATTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176782
FAM151A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 151, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-644s21c1
Sequence:CCGGGGATCAACGCTGACATCTTAACTCGAGTTAAGATGTCAGCGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-984s21c1
Sequence:CCGGTCTGCTCTACGTCCGGGATAACTCGAGTTATCCCGGACGTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-170s21c1
Sequence:CCGGAGTGGGTGTTTGCCGGCATTACTCGAGTAATGCCGGCAAACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-680s21c1
Sequence:CCGGTCATCTCAACTGAGGTCAATGCTCGAGCATTGACCTCAGTTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1007s1c1
Sequence:CCGGGCTGTCCACCAAGTCTACTATCTCGAGATAGTAGACTTGGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1072s1c1
Sequence:CCGGGAATGCCACACGGAAACCAATCTCGAGATTGGTTTCCGTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176782
FAM151A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 151, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-644s21c1
Sequence:CCGGGGATCAACGCTGACATCTTAACTCGAGTTAAGATGTCAGCGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-984s21c1
Sequence:CCGGTCTGCTCTACGTCCGGGATAACTCGAGTTATCCCGGACGTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-170s21c1
Sequence:CCGGAGTGGGTGTTTGCCGGCATTACTCGAGTAATGCCGGCAAACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-680s21c1
Sequence:CCGGTCATCTCAACTGAGGTCAATGCTCGAGCATTGACCTCAGTTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1007s1c1
Sequence:CCGGGCTGTCCACCAAGTCTACTATCTCGAGATAGTAGACTTGGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1072s1c1
Sequence:CCGGGAATGCCACACGGAAACCAATCTCGAGATTGGTTTCCGTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176782
FAM151A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 151, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-644s21c1
Sequence:CCGGGGATCAACGCTGACATCTTAACTCGAGTTAAGATGTCAGCGTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-984s21c1
Sequence:CCGGTCTGCTCTACGTCCGGGATAACTCGAGTTATCCCGGACGTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-170s21c1
Sequence:CCGGAGTGGGTGTTTGCCGGCATTACTCGAGTAATGCCGGCAAACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176782.2-680s21c1
Sequence:CCGGTCATCTCAACTGAGGTCAATGCTCGAGCATTGACCTCAGTTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1007s1c1
Sequence:CCGGGCTGTCCACCAAGTCTACTATCTCGAGATAGTAGACTTGGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176782.1-1072s1c1
Sequence:CCGGGAATGCCACACGGAAACCAATCTCGAGATTGGTTTCCGTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks