EMAIL THIS PAGE TO A FRIEND

FAM153A

family with sequence similarity 153, member A

25 Gene Product Result for
Synonyms: NY-REN-7
Species: Human FAM153A(285596)
UniProtKB ID: Q9UHL3, A8K0F3, O94852
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173663 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115171 MISSION® esiRNA esiRNA human FAM153A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173663 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368583 predicted 539
2 SASI_Hs02_00368584 predicted 1008
3 SASI_Hs02_00368585 predicted 533
4 SASI_Hs01_00044010 predicted 1322
5 SASI_Hs02_00368586 predicted 1009
6 SASI_Hs02_00368587 predicted 221
7 SASI_Hs01_00044012 predicted 1146
8 SASI_Hs01_00044013 predicted 278
9 SASI_Hs01_00044014 predicted 390
10 SASI_Hs01_00044015 predicted 351
11 SASI_Hs01_00044009 predicted 1410
12 SASI_Hs01_00044011 predicted 718
13 SASI_Hs01_00044016 predicted 913
14 SASI_Hs01_00044017 predicted 447
15 SASI_Hs01_00044018 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173663
FAM153A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 153, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173663.3-528s21c1
Sequence:CCGGCAGACACACTGGCCGAATTTCCTCGAGGAAATTCGGCCAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1330s21c1
Sequence:CCGGACACTAGGGTTGACATGAATCCTCGAGGATTCATGTCAACCCTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1498s21c1
Sequence:CCGGGATCCAAGAAGCACTGAAATGCTCGAGCATTTCAGTGCTTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173663.1-1411s1c1
Sequence:CCGGCAGCTCACCAACATCTCATTTCTCGAGAAATGAGATGTTGGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1182s1c1
Sequence:CCGGGTCCTGAAATGTTGGGACATTCTCGAGAATGTCCCAACATTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1017s1c1
Sequence:CCGGCAATTGGAAGACTCCACCATTCTCGAGAATGGTGGAGTCTTCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-501s1c1
Sequence:CCGGGTATGCTTTCCATCAGAAGATCTCGAGATCTTCTGATGGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-516s1c1
Sequence:CCGGGAAGATCATCTAGAGGAGTTTCTCGAGAAACTCCTCTAGATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173663
FAM153A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 153, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173663.3-528s21c1
Sequence:CCGGCAGACACACTGGCCGAATTTCCTCGAGGAAATTCGGCCAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1330s21c1
Sequence:CCGGACACTAGGGTTGACATGAATCCTCGAGGATTCATGTCAACCCTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1498s21c1
Sequence:CCGGGATCCAAGAAGCACTGAAATGCTCGAGCATTTCAGTGCTTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173663.1-1411s1c1
Sequence:CCGGCAGCTCACCAACATCTCATTTCTCGAGAAATGAGATGTTGGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1182s1c1
Sequence:CCGGGTCCTGAAATGTTGGGACATTCTCGAGAATGTCCCAACATTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1017s1c1
Sequence:CCGGCAATTGGAAGACTCCACCATTCTCGAGAATGGTGGAGTCTTCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-501s1c1
Sequence:CCGGGTATGCTTTCCATCAGAAGATCTCGAGATCTTCTGATGGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-516s1c1
Sequence:CCGGGAAGATCATCTAGAGGAGTTTCTCGAGAAACTCCTCTAGATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173663
FAM153A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 153, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173663.3-528s21c1
Sequence:CCGGCAGACACACTGGCCGAATTTCCTCGAGGAAATTCGGCCAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1330s21c1
Sequence:CCGGACACTAGGGTTGACATGAATCCTCGAGGATTCATGTCAACCCTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173663.3-1498s21c1
Sequence:CCGGGATCCAAGAAGCACTGAAATGCTCGAGCATTTCAGTGCTTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173663.1-1411s1c1
Sequence:CCGGCAGCTCACCAACATCTCATTTCTCGAGAAATGAGATGTTGGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1182s1c1
Sequence:CCGGGTCCTGAAATGTTGGGACATTCTCGAGAATGTCCCAACATTTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-1017s1c1
Sequence:CCGGCAATTGGAAGACTCCACCATTCTCGAGAATGGTGGAGTCTTCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-501s1c1
Sequence:CCGGGTATGCTTTCCATCAGAAGATCTCGAGATCTTCTGATGGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173663.1-516s1c1
Sequence:CCGGGAAGATCATCTAGAGGAGTTTCTCGAGAAACTCCTCTAGATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks