EMAIL THIS PAGE TO A FRIEND

FAM153B

family with sequence similarity 153, member B

105 Gene Product Result for
Species: Human FAM153B(202134)
UniProtKB ID: P0C7A2, A8MTI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079529 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148391 MISSION® esiRNA esiRNA human FAM153B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079529 Rosetta Predictions human pricing
XM_371783 Rosetta Predictions human pricing
XM_927500 Rosetta Predictions human pricing
XM_932121 Rosetta Predictions human pricing
XM_932125 Rosetta Predictions human pricing
XM_932129 Rosetta Predictions human pricing
XM_932135 Rosetta Predictions human pricing
XM_932143 Rosetta Predictions human pricing
XM_932148 Rosetta Predictions human pricing
XM_932153 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313510 predicted 386
2 SASI_Hs02_00313511 predicted 546
3 SASI_Hs02_00313512 predicted 192
4 SASI_Hs02_00313513 predicted 713
5 SASI_Hs02_00313514 predicted 708
6 SASI_Hs02_00313515 predicted 694
7 SASI_Hs02_00313516 predicted 807
8 SASI_Hs02_00313517 predicted 594
9 SASI_Hs02_00313518 predicted 258
10 SASI_Hs02_00313519 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289548 predicted 420
2 SASI_Hs01_00289549 predicted 579
3 SASI_Hs01_00289550 predicted 227
4 SASI_Hs01_00289551 predicted 743
5 SASI_Hs01_00289552 predicted 219
6 SASI_Hs01_00289553 predicted 425
7 SASI_Hs01_00289554 predicted 740
8 SASI_Hs01_00289555 predicted 729
9 SASI_Hs01_00289556 predicted 842
10 SASI_Hs01_00289557 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252798 predicted 420
2 SASI_Hs01_00252799 predicted 583
3 SASI_Hs01_00252800 predicted 232
4 SASI_Hs01_00252801 predicted 742
5 SASI_Hs01_00252802 predicted 212
6 SASI_Hs01_00252803 predicted 434
7 SASI_Hs01_00252804 predicted 748
8 SASI_Hs01_00252805 predicted 730
9 SASI_Hs01_00252806 predicted 839
10 SASI_Hs01_00252807 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283204 predicted 899
2 SASI_Hs01_00283205 predicted 1182
3 SASI_Hs01_00283206 predicted 586
4 SASI_Hs01_00283207 predicted 572
5 SASI_Hs01_00283208 predicted 995
6 SASI_Hs01_00283209 predicted 686
7 SASI_Hs01_00283210 predicted 1061
8 SASI_Hs01_00283211 predicted 866
9 SASI_Hs01_00283212 predicted 478
10 SASI_Hs01_00283213 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259592 predicted 675
2 SASI_Hs01_00259593 predicted 956
3 SASI_Hs01_00259594 predicted 361
4 SASI_Hs01_00259595 predicted 342
5 SASI_Hs01_00259596 predicted 769
6 SASI_Hs01_00259597 predicted 461
7 SASI_Hs01_00259598 predicted 830
8 SASI_Hs01_00259599 predicted 635
9 SASI_Hs01_00259600 predicted 258
10 SASI_Hs01_00259601 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285917 predicted 757
2 SASI_Hs01_00285918 predicted 1039
3 SASI_Hs01_00285919 predicted 572
4 SASI_Hs01_00285920 predicted 368
5 SASI_Hs01_00285921 predicted 338
6 SASI_Hs01_00285922 predicted 866
7 SASI_Hs01_00285923 predicted 457
8 SASI_Hs01_00285924 predicted 923
9 SASI_Hs01_00285925 predicted 728
10 SASI_Hs01_00285926 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275168 predicted 1871
2 SASI_Hs01_00275169 predicted 1169
3 SASI_Hs01_00275170 predicted 1778
4 SASI_Hs01_00275171 predicted 923
5 SASI_Hs01_00275172 predicted 1018
6 SASI_Hs01_00275173 predicted 989
7 SASI_Hs01_00275174 predicted 769
8 SASI_Hs01_00275175 predicted 1371
9 SASI_Hs01_00275176 predicted 901
10 SASI_Hs01_00275177 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288285 predicted 419
2 SASI_Hs01_00288286 predicted 582
3 SASI_Hs01_00288287 predicted 232
4 SASI_Hs01_00288288 predicted 742
5 SASI_Hs01_00288289 predicted 216
6 SASI_Hs01_00288290 predicted 427
7 SASI_Hs01_00288291 predicted 740
8 SASI_Hs01_00288292 predicted 735
9 SASI_Hs01_00288293 predicted 846
10 SASI_Hs01_00288294 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286156 predicted 426
2 SASI_Hs01_00286157 predicted 579
3 SASI_Hs01_00286158 predicted 234
4 SASI_Hs01_00286159 predicted 748
5 SASI_Hs01_00286160 predicted 219
6 SASI_Hs01_00286161 predicted 425
7 SASI_Hs01_00286162 predicted 740
8 SASI_Hs01_00286163 predicted 735
9 SASI_Hs01_00286164 predicted 839
10 SASI_Hs01_00286165 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300943 predicted 423
2 SASI_Hs01_00300944 predicted 581
3 SASI_Hs01_00300945 predicted 231
4 SASI_Hs01_00300946 predicted 741
5 SASI_Hs01_00300947 predicted 218
6 SASI_Hs01_00300948 predicted 435
7 SASI_Hs01_00300949 predicted 742
8 SASI_Hs01_00300950 predicted 729
9 SASI_Hs01_00300951 predicted 841
10 SASI_Hs01_00300952 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079529
FAM153B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 153, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-98s21c1
Sequence:CCGGGCGAGGATGAAATAGTGTATCCTCGAGGATACACTATTTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-158s21c1
Sequence:CCGGGTGAGAAGCCAATCACCTATCCTCGAGGATAGGTGATTGGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-169s21c1
Sequence:CCGGATCACCTATCACTGGTATCACCTCGAGGTGATACCAGTGATAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079529.2-1882s21c1
Sequence:CCGGATCCATAGTATGGTAAGTTACCTCGAGGTAACTTACCATACTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-208s21c1
Sequence:CCGGTACCCTAGAGTTGCATCAATGCTCGAGCATTGATGCAACTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079529
FAM153B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 153, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-98s21c1
Sequence:CCGGGCGAGGATGAAATAGTGTATCCTCGAGGATACACTATTTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-158s21c1
Sequence:CCGGGTGAGAAGCCAATCACCTATCCTCGAGGATAGGTGATTGGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-169s21c1
Sequence:CCGGATCACCTATCACTGGTATCACCTCGAGGTGATACCAGTGATAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079529.2-1882s21c1
Sequence:CCGGATCCATAGTATGGTAAGTTACCTCGAGGTAACTTACCATACTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-208s21c1
Sequence:CCGGTACCCTAGAGTTGCATCAATGCTCGAGCATTGATGCAACTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079529
FAM153B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 153, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-98s21c1
Sequence:CCGGGCGAGGATGAAATAGTGTATCCTCGAGGATACACTATTTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-158s21c1
Sequence:CCGGGTGAGAAGCCAATCACCTATCCTCGAGGATAGGTGATTGGCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-169s21c1
Sequence:CCGGATCACCTATCACTGGTATCACCTCGAGGTGATACCAGTGATAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079529.2-1882s21c1
Sequence:CCGGATCCATAGTATGGTAAGTTACCTCGAGGTAACTTACCATACTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079529.2-208s21c1
Sequence:CCGGTACCCTAGAGTTGCATCAATGCTCGAGCATTGATGCAACTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks