EMAIL THIS PAGE TO A FRIEND

FAM153C

family with sequence similarity 153, member C

83 Gene Product Result for
Synonyms: NY-REN-7-like
Species: Human FAM153C(653316)
UniProtKB ID: Q494X1, A4IF33, B2RUV5, B7ZW12
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142191 MISSION® esiRNA esiRNA human FAM153C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079527 Rosetta Predictions human pricing
XM_001716960 Rosetta Predictions human pricing
XM_928754 Rosetta Predictions human pricing
XM_933102 Rosetta Predictions human pricing
XM_933113 Rosetta Predictions human pricing
XM_933119 Rosetta Predictions human pricing
XM_933126 Rosetta Predictions human pricing
XM_933130 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313490 predicted 1157
2 SASI_Hs02_00313491 predicted 1266
3 SASI_Hs02_00313492 predicted 1237
4 SASI_Hs02_00313493 predicted 1552
5 SASI_Hs02_00313494 predicted 1229
6 SASI_Hs02_00313495 predicted 1233
7 SASI_Hs02_00313496 predicted 853
8 SASI_Hs02_00313497 predicted 1366
9 SASI_Hs02_00313498 predicted 975
10 SASI_Hs02_00313499 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414105 predicted 283
2 SASI_Hs02_00414106 predicted 343
3 SASI_Hs02_00414107 predicted 40
4 SASI_Hs02_00414108 predicted 455
5 SASI_Hs02_00414109 predicted 338
6 SASI_Hs02_00414110 predicted 35
7 SASI_Hs02_00414111 predicted 460
8 SASI_Hs02_00414112 predicted 434
9 SASI_Hs02_00414113 predicted 441
10 SASI_Hs02_00414114 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270442 predicted 902
2 SASI_Hs01_00270443 predicted 856
3 SASI_Hs01_00270444 predicted 854
4 SASI_Hs01_00270445 predicted 856
5 SASI_Hs01_00270446 predicted 1000
6 SASI_Hs01_00270447 predicted 686
7 SASI_Hs01_00270448 predicted 685
8 SASI_Hs01_00270449 predicted 638
9 SASI_Hs01_00270450 predicted 996
10 SASI_Hs01_00270451 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298123 predicted 645
2 SASI_Hs01_00298124 predicted 765
3 SASI_Hs01_00298125 predicted 941
4 SASI_Hs01_00298126 predicted 1042
5 SASI_Hs01_00298127 predicted 565
6 SASI_Hs01_00298128 predicted 855
7 SASI_Hs01_00298129 predicted 466
8 SASI_Hs01_00298130 predicted 917
9 SASI_Hs01_00298131 predicted 1039
10 SASI_Hs01_00298132 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262064 predicted 667
2 SASI_Hs01_00262065 predicted 631
3 SASI_Hs01_00262066 predicted 629
4 SASI_Hs01_00262067 predicted 623
5 SASI_Hs01_00262068 predicted 774
6 SASI_Hs01_00262069 predicted 470
7 SASI_Hs01_00262070 predicted 459
8 SASI_Hs01_00262071 predicted 412
9 SASI_Hs01_00262072 predicted 776
10 SASI_Hs01_00262073 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280729 predicted 309
2 SASI_Hs01_00280730 predicted 488
3 SASI_Hs01_00280731 predicted 485
4 SASI_Hs01_00280732 predicted 368
5 SASI_Hs01_00280733 predicted 492
6 SASI_Hs01_00280734 predicted 77
7 SASI_Hs01_00280735 predicted 461
8 SASI_Hs01_00280736 predicted 463
9 SASI_Hs01_00280737 predicted 190
10 SASI_Hs01_00280738 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269069 predicted 488
2 SASI_Hs01_00269070 predicted 498
3 SASI_Hs01_00269071 predicted 483
4 SASI_Hs01_00269072 predicted 904
5 SASI_Hs01_00269073 predicted 490
6 SASI_Hs01_00269074 predicted 460
7 SASI_Hs01_00269075 predicted 467
8 SASI_Hs01_00269076 predicted 196
9 SASI_Hs01_00269077 predicted 892
10 SASI_Hs01_00269078 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278332 predicted 493
2 SASI_Hs01_00278333 predicted 490
3 SASI_Hs01_00278334 predicted 487
4 SASI_Hs01_00278335 predicted 903
5 SASI_Hs01_00278336 predicted 496
6 SASI_Hs01_00278337 predicted 463
7 SASI_Hs01_00278338 predicted 464
8 SASI_Hs01_00278339 predicted 196
9 SASI_Hs01_00278340 predicted 892
10 SASI_Hs01_00278341 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079527
FAM153C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 153, member C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-1095s21c1
Sequence:CCGGAGTGTGCAGTGCGCAGAATGACTCGAGTCATTCTGCGCACTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-804s21c1
Sequence:CCGGACTACGGGAGCTCCACCTATACTCGAGTATAGGTGGAGCTCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079527.1-1144s21c1
Sequence:CCGGTTCTTGGCTACGCTCACTTTCCTCGAGGAAAGTGAGCGTAGCCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-839s21c1
Sequence:CCGGAGTACCAAGAGGCGATGAAGACTCGAGTCTTCATCGCCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-987s21c1
Sequence:CCGGATTGGAAGACTCCACCATTACCTCGAGGTAATGGTGGAGTCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079527
FAM153C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 153, member C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-1095s21c1
Sequence:CCGGAGTGTGCAGTGCGCAGAATGACTCGAGTCATTCTGCGCACTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-804s21c1
Sequence:CCGGACTACGGGAGCTCCACCTATACTCGAGTATAGGTGGAGCTCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079527.1-1144s21c1
Sequence:CCGGTTCTTGGCTACGCTCACTTTCCTCGAGGAAAGTGAGCGTAGCCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-839s21c1
Sequence:CCGGAGTACCAAGAGGCGATGAAGACTCGAGTCTTCATCGCCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-987s21c1
Sequence:CCGGATTGGAAGACTCCACCATTACCTCGAGGTAATGGTGGAGTCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079527
FAM153C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 153, member C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-1095s21c1
Sequence:CCGGAGTGTGCAGTGCGCAGAATGACTCGAGTCATTCTGCGCACTGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-804s21c1
Sequence:CCGGACTACGGGAGCTCCACCTATACTCGAGTATAGGTGGAGCTCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079527.1-1144s21c1
Sequence:CCGGTTCTTGGCTACGCTCACTTTCCTCGAGGAAAGTGAGCGTAGCCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-839s21c1
Sequence:CCGGAGTACCAAGAGGCGATGAAGACTCGAGTCTTCATCGCCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079527.1-987s21c1
Sequence:CCGGATTGGAAGACTCCACCATTACCTCGAGGTAATGGTGGAGTCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks