EMAIL THIS PAGE TO A FRIEND

FAM154A

family with sequence similarity 154, member A

86 Gene Product Result for
Synonyms: C9orf138
UniProtKB ID: Q8IYX7, Q5VY58
Gene ID:
Mouse(75811) family with sequence similarity 154, member A
Rat(679802) family with sequence similarity 154, member A
chicken(101668074) family with sequence similarity 154, member A
domestic cat(101082526) family with sequence similarity 154, member A
cow(539526) family with sequence similarity 154, member A
dog(474718) family with sequence similarity 154, member A
chicken(101751429) family with sequence similarity 154, member A
naked mole-rat(101720485) family with sequence similarity 154, member A
domestic guinea pig(100714406) family with sequence similarity 154, member A
sheep(101123094) family with sequence similarity 154, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153707 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056471 MISSION® esiRNA esiRNA human FAM154A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153707 Rosetta Predictions human pricing
XM_001054528 Rosetta Predictions rat pricing
NM_001081096 Rosetta Predictions mouse pricing
XM_131470 Rosetta Predictions mouse pricing
XM_899113 Rosetta Predictions mouse pricing
XM_899124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015386 predicted 567
2 SASI_Hs01_00015387 predicted 1441
3 SASI_Hs01_00015388 predicted 502
4 SASI_Hs02_00367432 predicted 339
5 SASI_Hs01_00015390 predicted 679
6 SASI_Hs01_00015392 predicted 1176
7 SASI_Hs01_00015393 predicted 824
8 SASI_Hs01_00015394 predicted 884
9 SASI_Hs02_00367433 predicted 632
10 SASI_Hs02_00367434 predicted 654
11 SASI_Hs01_00015385 predicted 651
12 SASI_Hs01_00015389 predicted 558
13 SASI_Hs01_00015391 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276149 predicted 386
2 SASI_Rn02_00276150 predicted 335
3 SASI_Rn02_00276151 predicted 585
4 SASI_Rn02_00276152 predicted 624
5 SASI_Rn02_00276153 predicted 430
6 SASI_Rn02_00276154 predicted 359
7 SASI_Rn02_00276155 predicted 329
8 SASI_Rn02_00276156 predicted 257
9 SASI_Rn02_00276157 predicted 494
10 SASI_Rn02_00276158 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295141 predicted 648
2 SASI_Mm02_00295142 predicted 1152
3 SASI_Mm02_00295143 predicted 1421
4 SASI_Mm02_00295144 predicted 571
5 SASI_Mm02_00295145 predicted 702
6 SASI_Mm02_00295146 predicted 579
7 SASI_Mm02_00295147 predicted 395
8 SASI_Mm02_00295148 predicted 581
9 SASI_Mm02_00295149 predicted 572
10 SASI_Mm02_00295150 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222956 predicted 1160
2 SASI_Mm01_00222957 predicted 1421
3 SASI_Mm01_00222958 predicted 1286
4 SASI_Mm01_00222959 predicted 1493
5 SASI_Mm01_00222960 predicted 1439
6 SASI_Mm01_00222961 predicted 1381
7 SASI_Mm01_00222962 predicted 1225
8 SASI_Mm01_00222963 predicted 1466
9 SASI_Mm01_00222964 predicted 1345
10 SASI_Mm01_00222965 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213515 predicted 371
2 SASI_Mm01_00213516 predicted 436
3 SASI_Mm01_00213517 predicted 583
4 SASI_Mm01_00213518 predicted 435
5 SASI_Mm01_00213519 predicted 436
6 SASI_Mm01_00213520 predicted 542
7 SASI_Mm01_00213521 predicted 418
8 SASI_Mm01_00213522 predicted 501
9 SASI_Mm01_00213523 predicted 515
10 SASI_Mm01_00213524 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253358 predicted 471
2 SASI_Mm01_00253359 predicted 978
3 SASI_Mm01_00253360 predicted 1253
4 SASI_Mm01_00253361 predicted 408
5 SASI_Mm01_00253362 predicted 532
6 SASI_Mm01_00253363 predicted 474
7 SASI_Mm01_00253364 predicted 409
8 SASI_Mm01_00253365 predicted 396
9 SASI_Mm01_00253366 predicted 385
10 SASI_Mm01_00253367 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081096
FAM154A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 154, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1614s21c1
Sequence:CCGGCAAGATCTATAGGTCAATTTCCTCGAGGAAATTGACCTATAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-404s21c1
Sequence:CCGGCCGAGAATTATCCGATCTATCCTCGAGGATAGATCGGATAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1430s21c1
Sequence:CCGGTGGCGCATCCACCTATCATTACTCGAGTAATGATAGGTGGATGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-344s21c1
Sequence:CCGGCACATCTCCCTACGAAGATTTCTCGAGAAATCTTCGTAGGGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-589s21c1
Sequence:CCGGGATTTACTCACAACGTATAAACTCGAGTTTATACGTTGTGAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081096
FAM154A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 154, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1614s21c1
Sequence:CCGGCAAGATCTATAGGTCAATTTCCTCGAGGAAATTGACCTATAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-404s21c1
Sequence:CCGGCCGAGAATTATCCGATCTATCCTCGAGGATAGATCGGATAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1430s21c1
Sequence:CCGGTGGCGCATCCACCTATCATTACTCGAGTAATGATAGGTGGATGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-344s21c1
Sequence:CCGGCACATCTCCCTACGAAGATTTCTCGAGAAATCTTCGTAGGGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-589s21c1
Sequence:CCGGGATTTACTCACAACGTATAAACTCGAGTTTATACGTTGTGAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081096
FAM154A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 154, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1614s21c1
Sequence:CCGGCAAGATCTATAGGTCAATTTCCTCGAGGAAATTGACCTATAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-404s21c1
Sequence:CCGGCCGAGAATTATCCGATCTATCCTCGAGGATAGATCGGATAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-1430s21c1
Sequence:CCGGTGGCGCATCCACCTATCATTACTCGAGTAATGATAGGTGGATGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-344s21c1
Sequence:CCGGCACATCTCCCTACGAAGATTTCTCGAGAAATCTTCGTAGGGAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081096.1-589s21c1
Sequence:CCGGGATTTACTCACAACGTATAAACTCGAGTTTATACGTTGTGAGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153707
FAM154A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 154, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-675s21c1
Sequence:CCGGATGGAGTGTTTGCCTACTTATCTCGAGATAAGTAGGCAAACACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-1089s21c1
Sequence:CCGGACCACTGAGTTTCGAGATAAGCTCGAGCTTATCTCGAAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-575s21c1
Sequence:CCGGGGATTTGCTCACGACGTATAACTCGAGTTATACGTCGTGAGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-370s21c1
Sequence:CCGGCATGTCTTCTCTCCGAATATACTCGAGTATATTCGGAGAGAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-450s21c1
Sequence:CCGGGAGTACCAGAAAGGGTCTATACTCGAGTATAGACCCTTTCTGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153707.1-1596s1c1
Sequence:CCGGCACAGGATATACAAACCAGTTCTCGAGAACTGGTTTGTATATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153707
FAM154A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 154, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-675s21c1
Sequence:CCGGATGGAGTGTTTGCCTACTTATCTCGAGATAAGTAGGCAAACACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-1089s21c1
Sequence:CCGGACCACTGAGTTTCGAGATAAGCTCGAGCTTATCTCGAAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-575s21c1
Sequence:CCGGGGATTTGCTCACGACGTATAACTCGAGTTATACGTCGTGAGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-370s21c1
Sequence:CCGGCATGTCTTCTCTCCGAATATACTCGAGTATATTCGGAGAGAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-450s21c1
Sequence:CCGGGAGTACCAGAAAGGGTCTATACTCGAGTATAGACCCTTTCTGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153707.1-1596s1c1
Sequence:CCGGCACAGGATATACAAACCAGTTCTCGAGAACTGGTTTGTATATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153707
FAM154A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 154, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-675s21c1
Sequence:CCGGATGGAGTGTTTGCCTACTTATCTCGAGATAAGTAGGCAAACACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-1089s21c1
Sequence:CCGGACCACTGAGTTTCGAGATAAGCTCGAGCTTATCTCGAAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-575s21c1
Sequence:CCGGGGATTTGCTCACGACGTATAACTCGAGTTATACGTCGTGAGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-370s21c1
Sequence:CCGGCATGTCTTCTCTCCGAATATACTCGAGTATATTCGGAGAGAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153707.1-450s21c1
Sequence:CCGGGAGTACCAGAAAGGGTCTATACTCGAGTATAGACCCTTTCTGGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153707.1-1596s1c1
Sequence:CCGGCACAGGATATACAAACCAGTTCTCGAGAACTGGTTTGTATATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks