EMAIL THIS PAGE TO A FRIEND

FAM154B

family with sequence similarity 154, member B

115 Gene Product Result for
UniProtKB ID: Q658L1
Gene ID:
Mouse(330577) family with sequence similarity 154, member B
Rat(293061) family with sequence similarity 154, member B
sheep(101107638) family with sequence similarity 154, member B
domestic guinea pig(100722565) family with sequence similarity 154, member B
naked mole-rat(101709276) family with sequence similarity 154, member B
Zebrafish(641580) family with sequence similarity 154, member B
chicken(427505) family with sequence similarity 154, member B
domestic cat(101095176) family with sequence similarity 154, member B
cow(538044) family with sequence similarity 154, member B
dog(488758) family with sequence similarity 154, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008226 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008226 Rosetta Predictions human pricing
NM_001106277 Rosetta Predictions rat pricing
NM_177894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055463 predicted 1086
2 SASI_Hs01_00055464 predicted 1042
3 SASI_Hs02_00305388 predicted 816
4 SASI_Hs01_00055465 predicted 1018
5 SASI_Hs01_00055466 predicted 215
6 SASI_Hs02_00305389 predicted 209
7 SASI_Hs01_00055468 predicted 314
8 SASI_Hs01_00055470 predicted 1058
9 SASI_Hs02_00305390 predicted 207
10 SASI_Hs02_00305391 predicted 635
11 SASI_Hs01_00055462 predicted 265
12 SASI_Hs01_00055467 predicted 524
13 SASI_Hs01_00055469 predicted 378
14 SASI_Hs01_00055471 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217388 predicted 1103
2 SASI_Rn02_00217389 predicted 1043
3 SASI_Rn02_00217390 predicted 1030
4 SASI_Rn02_00217391 predicted 793
5 SASI_Rn02_00217392 predicted 1233
6 SASI_Rn02_00217393 predicted 685
7 SASI_Rn02_00217394 predicted 202
8 SASI_Rn02_00217395 predicted 424
9 SASI_Rn02_00217396 predicted 630
10 SASI_Rn02_00217397 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067616 predicted 1378
2 SASI_Mm01_00067617 predicted 1109
3 SASI_Mm01_00067618 predicted 1047
4 SASI_Mm01_00067619 predicted 1033
5 SASI_Mm01_00067620 predicted 1137
6 SASI_Mm01_00067621 predicted 687
7 SASI_Mm01_00067622 predicted 1239
8 SASI_Mm01_00067623 predicted 712
9 SASI_Mm01_00067624 predicted 419
10 SASI_Mm01_00067625 predicted 785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177894
FAM154B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 154, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-401s1c1
Sequence:CCGGCCCAGATGTGAAATTCGGAAACTCGAGTTTCCGAATTTCACATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-416s1c1
Sequence:CCGGCGGAAACTCAACTACATTTCACTCGAGTGAAATGTAGTTGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.4-533s1c1
Sequence:CCGGCAAGTCATCGTCGAGATTATGCTCGAGCATAATCTCGACGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177894.4-2150s1c1
Sequence:CCGGCCATACAGCAAGGACTATAAACTCGAGTTTATAGTCCTTGCTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-969s21c1
Sequence:CCGGTTGTCGCCAAGGACTTATTAACTCGAGTTAATAAGTCCTTGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177894.4-1902s21c1
Sequence:CCGGTACTGATATCTTCGGTTTATACTCGAGTATAAACCGAAGATATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-531s21c1
Sequence:CCGGTACAAGTCATCGTCGAGATTACTCGAGTAATCTCGACGATGACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-317s21c1
Sequence:CCGGTGGACACTGTCCCAACTTATACTCGAGTATAAGTTGGGACAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-344s21c1
Sequence:CCGGATTATAGATCTTGGGATATTCCTCGAGGAATATCCCAAGATCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177894
FAM154B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 154, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-401s1c1
Sequence:CCGGCCCAGATGTGAAATTCGGAAACTCGAGTTTCCGAATTTCACATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-416s1c1
Sequence:CCGGCGGAAACTCAACTACATTTCACTCGAGTGAAATGTAGTTGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.4-533s1c1
Sequence:CCGGCAAGTCATCGTCGAGATTATGCTCGAGCATAATCTCGACGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177894.4-2150s1c1
Sequence:CCGGCCATACAGCAAGGACTATAAACTCGAGTTTATAGTCCTTGCTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-969s21c1
Sequence:CCGGTTGTCGCCAAGGACTTATTAACTCGAGTTAATAAGTCCTTGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177894.4-1902s21c1
Sequence:CCGGTACTGATATCTTCGGTTTATACTCGAGTATAAACCGAAGATATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-531s21c1
Sequence:CCGGTACAAGTCATCGTCGAGATTACTCGAGTAATCTCGACGATGACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-317s21c1
Sequence:CCGGTGGACACTGTCCCAACTTATACTCGAGTATAAGTTGGGACAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-344s21c1
Sequence:CCGGATTATAGATCTTGGGATATTCCTCGAGGAATATCCCAAGATCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177894
FAM154B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 154, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-401s1c1
Sequence:CCGGCCCAGATGTGAAATTCGGAAACTCGAGTTTCCGAATTTCACATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.3-416s1c1
Sequence:CCGGCGGAAACTCAACTACATTTCACTCGAGTGAAATGTAGTTGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177894.4-533s1c1
Sequence:CCGGCAAGTCATCGTCGAGATTATGCTCGAGCATAATCTCGACGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177894.4-2150s1c1
Sequence:CCGGCCATACAGCAAGGACTATAAACTCGAGTTTATAGTCCTTGCTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-969s21c1
Sequence:CCGGTTGTCGCCAAGGACTTATTAACTCGAGTTAATAAGTCCTTGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177894.4-1902s21c1
Sequence:CCGGTACTGATATCTTCGGTTTATACTCGAGTATAAACCGAAGATATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-531s21c1
Sequence:CCGGTACAAGTCATCGTCGAGATTACTCGAGTAATCTCGACGATGACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-317s21c1
Sequence:CCGGTGGACACTGTCCCAACTTATACTCGAGTATAAGTTGGGACAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177894.4-344s21c1
Sequence:CCGGATTATAGATCTTGGGATATTCCTCGAGGAATATCCCAAGATCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008226
FAM154B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 154, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008226.1-800s1c1
Sequence:CCGGGCATGCTGTTAAACAGCACAACTCGAGTTGTGCTGTTTAACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-387s1c1
Sequence:CCGGGCCTACTGTGAAATTTGGAAACTCGAGTTTCCAAATTTCACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008226.1-2433s1c1
Sequence:CCGGGCCTGTAGCAAGGATTGTAAACTCGAGTTTACAATCCTTGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008226.1-1677s1c1
Sequence:CCGGCCAAGGCAACAGGATTCATTACTCGAGTAATGAATCCTGTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-544s1c1
Sequence:CCGGCAGCTTGAACTCAAGTTTGAACTCGAGTTCAAACTTGAGTTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-1236s1c1
Sequence:CCGGCAAGATTATTCCTGCAGTGAACTCGAGTTCACTGCAGGAATAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-822s1c1
Sequence:CCGGCCATCTTGACTATGTTCCATACTCGAGTATGGAACATAGTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008226.1-517s21c1
Sequence:CCGGAGTCATCGCCTTGATTATATACTCGAGTATATAATCAAGGCGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008226.1-1580s21c1
Sequence:CCGGTATGGCAATTGTATGGTTATTCTCGAGAATAACCATACAATTGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008226
FAM154B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 154, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008226.1-800s1c1
Sequence:CCGGGCATGCTGTTAAACAGCACAACTCGAGTTGTGCTGTTTAACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-387s1c1
Sequence:CCGGGCCTACTGTGAAATTTGGAAACTCGAGTTTCCAAATTTCACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008226.1-2433s1c1
Sequence:CCGGGCCTGTAGCAAGGATTGTAAACTCGAGTTTACAATCCTTGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008226.1-1677s1c1
Sequence:CCGGCCAAGGCAACAGGATTCATTACTCGAGTAATGAATCCTGTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-544s1c1
Sequence:CCGGCAGCTTGAACTCAAGTTTGAACTCGAGTTCAAACTTGAGTTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-1236s1c1
Sequence:CCGGCAAGATTATTCCTGCAGTGAACTCGAGTTCACTGCAGGAATAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-822s1c1
Sequence:CCGGCCATCTTGACTATGTTCCATACTCGAGTATGGAACATAGTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008226.1-517s21c1
Sequence:CCGGAGTCATCGCCTTGATTATATACTCGAGTATATAATCAAGGCGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008226.1-1580s21c1
Sequence:CCGGTATGGCAATTGTATGGTTATTCTCGAGAATAACCATACAATTGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008226
FAM154B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 154, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008226.1-800s1c1
Sequence:CCGGGCATGCTGTTAAACAGCACAACTCGAGTTGTGCTGTTTAACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-387s1c1
Sequence:CCGGGCCTACTGTGAAATTTGGAAACTCGAGTTTCCAAATTTCACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008226.1-2433s1c1
Sequence:CCGGGCCTGTAGCAAGGATTGTAAACTCGAGTTTACAATCCTTGCTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008226.1-1677s1c1
Sequence:CCGGCCAAGGCAACAGGATTCATTACTCGAGTAATGAATCCTGTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-544s1c1
Sequence:CCGGCAGCTTGAACTCAAGTTTGAACTCGAGTTCAAACTTGAGTTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-1236s1c1
Sequence:CCGGCAAGATTATTCCTGCAGTGAACTCGAGTTCACTGCAGGAATAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008226.1-822s1c1
Sequence:CCGGCCATCTTGACTATGTTCCATACTCGAGTATGGAACATAGTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008226.1-517s21c1
Sequence:CCGGAGTCATCGCCTTGATTATATACTCGAGTATATAATCAAGGCGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008226.1-1580s21c1
Sequence:CCGGTATGGCAATTGTATGGTTATTCTCGAGAATAACCATACAATTGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks