EMAIL THIS PAGE TO A FRIEND

FAM155A

family with sequence similarity 155, member A

54 Gene Product Result for
UniProtKB ID: B1AL88, B2RUV1, B7Z334
Gene ID:
Mouse(270028) family with sequence similarity 155, member A
Rat(498667) family with sequence similarity 155, member A
Zebrafish(100149983) family with sequence similarity 155, member A
chicken(768473) family with sequence similarity 155, member A
cow(616912) family with sequence similarity 155, member A
domestic cat(101088903) family with sequence similarity 155, member A
dog(100688758) family with sequence similarity 155, member A
naked mole-rat(101722714) family with sequence similarity 155, member A
domestic guinea pig(100731503) family with sequence similarity 155, member A
sheep(101114789) family with sequence similarity 155, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080396 Rosetta Predictions human pricing
XM_001076507 Rosetta Predictions rat pricing
XM_573950 Rosetta Predictions rat pricing
NM_173446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314451 predicted 1498
2 SASI_Hs02_00314452 predicted 1115
3 SASI_Hs02_00314453 predicted 1131
4 SASI_Hs02_00314454 predicted 1226
5 SASI_Hs02_00314455 predicted 1031
6 SASI_Hs02_00314456 predicted 1255
7 SASI_Hs02_00314457 predicted 1154
8 SASI_Hs02_00314458 predicted 1214
9 SASI_Hs02_00314459 predicted 1188
10 SASI_Hs02_00314460 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353507 predicted 1184
2 SASI_Rn02_00353508 predicted 1479
3 SASI_Rn02_00353509 predicted 1331
4 SASI_Rn02_00353510 predicted 1567
5 SASI_Rn02_00353511 predicted 1262
6 SASI_Rn02_00353512 predicted 1235
7 SASI_Rn02_00353513 predicted 1604
8 SASI_Rn02_00353514 predicted 1368
9 SASI_Rn02_00353515 predicted 1139
10 SASI_Rn02_00353516 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401085 predicted 1184
2 SASI_Rn02_00401086 predicted 1337
3 SASI_Rn02_00401087 predicted 1482
4 SASI_Rn02_00401088 predicted 1573
5 SASI_Rn02_00401089 predicted 1421
6 SASI_Rn02_00401090 predicted 1230
7 SASI_Rn02_00401091 predicted 1606
8 SASI_Rn02_00401092 predicted 1139
9 SASI_Rn02_00401093 predicted 1490
10 SASI_Rn02_00401094 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034884 predicted 848
2 SASI_Mm01_00034885 predicted 712
3 SASI_Mm01_00034886 predicted 1144
4 SASI_Mm01_00034887 predicted 1004
5 SASI_Mm01_00034888 predicted 937
6 SASI_Mm01_00034889 predicted 1153
7 SASI_Mm01_00034890 predicted 897
8 SASI_Mm01_00034891 predicted 924
9 SASI_Mm01_00034893 predicted 808
10 SASI_Mm02_00345353 predicted 1280
11 SASI_Mm01_00034892 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080396
FAM155A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 155, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1150s21c1
Sequence:CCGGTCAGACGAGGTGTCCATTTATCTCGAGATAAATGGACACCTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-166s21c1
Sequence:CCGGGCAGTATGACGACGGCTTAAACTCGAGTTTAAGCCGTCGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-986s21c1
Sequence:CCGGGAAAGCGTGCTCCACAAATATCTCGAGATATTTGTGGAGCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1014s21c1
Sequence:CCGGCGGAGGAGTACTCGGTGAAATCTCGAGATTTCACCGAGTACTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080396.1-3229s21c1
Sequence:CCGGTAACCTCTGCATCATACTTAACTCGAGTTAAGTATGATGCAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080396
FAM155A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 155, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1150s21c1
Sequence:CCGGTCAGACGAGGTGTCCATTTATCTCGAGATAAATGGACACCTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-166s21c1
Sequence:CCGGGCAGTATGACGACGGCTTAAACTCGAGTTTAAGCCGTCGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-986s21c1
Sequence:CCGGGAAAGCGTGCTCCACAAATATCTCGAGATATTTGTGGAGCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1014s21c1
Sequence:CCGGCGGAGGAGTACTCGGTGAAATCTCGAGATTTCACCGAGTACTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080396.1-3229s21c1
Sequence:CCGGTAACCTCTGCATCATACTTAACTCGAGTTAAGTATGATGCAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080396
FAM155A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 155, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1150s21c1
Sequence:CCGGTCAGACGAGGTGTCCATTTATCTCGAGATAAATGGACACCTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-166s21c1
Sequence:CCGGGCAGTATGACGACGGCTTAAACTCGAGTTTAAGCCGTCGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-986s21c1
Sequence:CCGGGAAAGCGTGCTCCACAAATATCTCGAGATATTTGTGGAGCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080396.1-1014s21c1
Sequence:CCGGCGGAGGAGTACTCGGTGAAATCTCGAGATTTCACCGAGTACTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080396.1-3229s21c1
Sequence:CCGGTAACCTCTGCATCATACTTAACTCGAGTTAAGTATGATGCAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173446
FAM155A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 155, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-2400s1c1
Sequence:CCGGGCAGAGACCAAGAACGCAAATCTCGAGATTTGCGTTCTTGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-1747s1c1
Sequence:CCGGGCACTTGTTAATGCAGGATTTCTCGAGAAATCCTGCATTAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-861s1c1
Sequence:CCGGGAGAAGTACGAAGAGTTTGAACTCGAGTTCAAACTCTTCGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-858s1c1
Sequence:CCGGCAGGAGAAGTACGAAGAGTTTCTCGAGAAACTCTTCGTACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173446
FAM155A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 155, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-2400s1c1
Sequence:CCGGGCAGAGACCAAGAACGCAAATCTCGAGATTTGCGTTCTTGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-1747s1c1
Sequence:CCGGGCACTTGTTAATGCAGGATTTCTCGAGAAATCCTGCATTAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-861s1c1
Sequence:CCGGGAGAAGTACGAAGAGTTTGAACTCGAGTTCAAACTCTTCGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-858s1c1
Sequence:CCGGCAGGAGAAGTACGAAGAGTTTCTCGAGAAACTCTTCGTACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173446
FAM155A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 155, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-2400s1c1
Sequence:CCGGGCAGAGACCAAGAACGCAAATCTCGAGATTTGCGTTCTTGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173446.1-1747s1c1
Sequence:CCGGGCACTTGTTAATGCAGGATTTCTCGAGAAATCCTGCATTAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-861s1c1
Sequence:CCGGGAGAAGTACGAAGAGTTTGAACTCGAGTTCAAACTCTTCGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173446.1-858s1c1
Sequence:CCGGCAGGAGAAGTACGAAGAGTTTCTCGAGAAACTCTTCGTACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks