EMAIL THIS PAGE TO A FRIEND

FAM155B

family with sequence similarity 155, member B

213 Gene Product Result for
Synonyms: CXorf63 TED TMEM28 bB57D9.1
UniProtKB ID: O75949, B1ALV6, B9EGK1, D3DVU1
Gene ID:
Human(27112) Summary: This gene encodes a product belonging to a family of proteins with unknown function. The presence of two transmembrane domains suggests that this protein is a multi-pass membrane protein. [provided by RefSeq, Sep 2011]
Rat(688841) family with sequence similarity 155, member B
Zebrafish(791161) family with sequence similarity 155, member B
cow(613918) family with sequence similarity 155, member B
domestic cat(101086120) family with sequence similarity 155, member B
dog(607468) family with sequence similarity 155, member B
chicken(769051) family with sequence similarity 155, member B
sheep(101120730) family with sequence similarity 155, member B
domestic guinea pig(100718121) family with sequence similarity 155, member B
naked mole-rat(101703988) family with sequence similarity 155, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015686 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044791 MISSION® esiRNA esiRNA human FAM155B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015686 Rosetta Predictions human pricing
XM_001068528 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172471 predicted 893
2 SASI_Hs01_00172472 predicted 56
3 SASI_Hs01_00172473 predicted 481
4 SASI_Hs01_00172474 predicted 477
5 SASI_Hs01_00172475 predicted 1473
6 SASI_Hs01_00172476 predicted 774
7 SASI_Hs01_00172477 predicted 495
8 SASI_Hs01_00172478 predicted 614
9 SASI_Hs01_00172479 predicted 1945
10 SASI_Hs01_00172480 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324825 predicted 1144
2 SASI_Rn02_00324826 predicted 973
3 SASI_Rn02_00324827 predicted 1145
4 SASI_Rn02_00324828 predicted 1067
5 SASI_Rn02_00324829 predicted 1049
6 SASI_Rn02_00324830 predicted 1083
7 SASI_Rn02_00324831 predicted 1053
8 SASI_Rn02_00324832 predicted 1178
9 SASI_Rn02_00324833 predicted 1067
10 SASI_Rn02_00324834 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015686
VALIDATED
FAM155B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 155, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-395s1c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-1160s1c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-614s1c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-1082s1c1
Sequence:CCGGGTTGCTGGATACTTCACCAAACTCGAGTTTGGTGAAGTATCCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-852s1c1
Sequence:CCGGCATAAATACTTACAGGCGGAACTCGAGTTCCGCCTGTAAGTATTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-484s1c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-896s1c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-1158s21c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-615s21c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-485s21c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-897s21c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-396s21c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015686
VALIDATED
FAM155B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 155, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-395s1c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-1160s1c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-614s1c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-1082s1c1
Sequence:CCGGGTTGCTGGATACTTCACCAAACTCGAGTTTGGTGAAGTATCCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-852s1c1
Sequence:CCGGCATAAATACTTACAGGCGGAACTCGAGTTCCGCCTGTAAGTATTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-484s1c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-896s1c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-1158s21c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-615s21c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-485s21c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-897s21c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-396s21c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015686
VALIDATED
FAM155B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 155, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-395s1c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-1160s1c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015686.1-614s1c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-1082s1c1
Sequence:CCGGGTTGCTGGATACTTCACCAAACTCGAGTTTGGTGAAGTATCCAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015686.1-852s1c1
Sequence:CCGGCATAAATACTTACAGGCGGAACTCGAGTTCCGCCTGTAAGTATTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-484s1c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015686.1-896s1c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-1158s21c1
Sequence:CCGGGAAGAAGTTCAAGGAGTCTGACTCGAGTCAGACTCCTTGAACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-615s21c1
Sequence:CCGGCCACTTTCGGAACTTCACTCTCTCGAGAGAGTGAAGTTCCGAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-485s21c1
Sequence:CCGGCTTGCACCAAATTGCAATCTTCTCGAGAAGATTGCAATTTGGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-897s21c1
Sequence:CCGGGAAAGGCTGTAAGGCTGTCTACTCGAGTAGACAGCCTTACAGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015686.2-396s21c1
Sequence:CCGGCAGATACAGCAACCTGACCAACTCGAGTTGGTCAGGTTGCTGTATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)