EMAIL THIS PAGE TO A FRIEND

FAM156A

family with sequence similarity 156, member A

75 Gene Product Result for
Synonyms: PRO0659 TMEM29
Species: Human FAM156A(29057), naked mole-rat Fam156a(101705560), domestic guinea pig Fam156a(100719831)
Gene ID:
naked mole-rat(101705560) family with sequence similarity 156, member A
domestic guinea pig(100719831) family with sequence similarity 156, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014138 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113491 MISSION® esiRNA esiRNA human FAM156B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014138 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106896 predicted 1882
2 SASI_Hs01_00106897 predicted 1988
3 SASI_Hs01_00106898 predicted 1005
4 SASI_Hs01_00106899 predicted 1904
5 SASI_Hs01_00106900 predicted 1917
6 SASI_Hs01_00106901 predicted 1980
7 SASI_Hs01_00106902 predicted 1740
8 SASI_Hs01_00106903 predicted 1754
9 SASI_Hs01_00106904 predicted 1253
10 SASI_Hs01_00106905 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014138
FAM156A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 156, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1532s1c1
Sequence:CCGGCTCAAGCAGTGGTTAGAGGAACTCGAGTTCCTCTAACCACTGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2021s1c1
Sequence:CCGGCCTGAGATCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2032s1c1
Sequence:CCGGGTTTCAAGAATGGGCAGGTAACTCGAGTTACCTGCCCATTCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1272s1c1
Sequence:CCGGGAAGTCAGAATCGATTCCGATCTCGAGATCGGAATCGATTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1284s1c1
Sequence:CCGGGATTCCGATGTGAATGTCGATCTCGAGATCGACATTCACATCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1266s1c1
Sequence:CCGGGTGACAGAAGTCAGAATCGATCTCGAGATCGATTCTGACTTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1160s1c1
Sequence:CCGGGAGTTCCTTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1277s1c1
Sequence:CCGGCAGAATCGATTCCGATGTGAACTCGAGTTCACATCGGAATCGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1283s1c1
Sequence:CCGGCGATTCCGATGTGAATGTCGACTCGAGTCGACATTCACATCGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1018s1c1
Sequence:CCGGGTACTCAGAACAGCCGATGATCTCGAGATCATCGGCTGTTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1293s1c1
Sequence:CCGGGTGAATGTCGATACTGCCAGACTCGAGTCTGGCAGTATCGACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1258s1c1
Sequence:CCGGCCCATTAGGTGACAGAAGTCACTCGAGTGACTTCTGTCACCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014138
FAM156A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 156, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1532s1c1
Sequence:CCGGCTCAAGCAGTGGTTAGAGGAACTCGAGTTCCTCTAACCACTGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2021s1c1
Sequence:CCGGCCTGAGATCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2032s1c1
Sequence:CCGGGTTTCAAGAATGGGCAGGTAACTCGAGTTACCTGCCCATTCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1272s1c1
Sequence:CCGGGAAGTCAGAATCGATTCCGATCTCGAGATCGGAATCGATTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1284s1c1
Sequence:CCGGGATTCCGATGTGAATGTCGATCTCGAGATCGACATTCACATCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1266s1c1
Sequence:CCGGGTGACAGAAGTCAGAATCGATCTCGAGATCGATTCTGACTTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1160s1c1
Sequence:CCGGGAGTTCCTTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1277s1c1
Sequence:CCGGCAGAATCGATTCCGATGTGAACTCGAGTTCACATCGGAATCGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1283s1c1
Sequence:CCGGCGATTCCGATGTGAATGTCGACTCGAGTCGACATTCACATCGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1018s1c1
Sequence:CCGGGTACTCAGAACAGCCGATGATCTCGAGATCATCGGCTGTTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1293s1c1
Sequence:CCGGGTGAATGTCGATACTGCCAGACTCGAGTCTGGCAGTATCGACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1258s1c1
Sequence:CCGGCCCATTAGGTGACAGAAGTCACTCGAGTGACTTCTGTCACCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014138
FAM156A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 156, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1532s1c1
Sequence:CCGGCTCAAGCAGTGGTTAGAGGAACTCGAGTTCCTCTAACCACTGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2021s1c1
Sequence:CCGGCCTGAGATCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014138.3-2032s1c1
Sequence:CCGGGTTTCAAGAATGGGCAGGTAACTCGAGTTACCTGCCCATTCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1272s1c1
Sequence:CCGGGAAGTCAGAATCGATTCCGATCTCGAGATCGGAATCGATTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1284s1c1
Sequence:CCGGGATTCCGATGTGAATGTCGATCTCGAGATCGACATTCACATCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1266s1c1
Sequence:CCGGGTGACAGAAGTCAGAATCGATCTCGAGATCGATTCTGACTTCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1160s1c1
Sequence:CCGGGAGTTCCTTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1277s1c1
Sequence:CCGGCAGAATCGATTCCGATGTGAACTCGAGTTCACATCGGAATCGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1283s1c1
Sequence:CCGGCGATTCCGATGTGAATGTCGACTCGAGTCGACATTCACATCGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1018s1c1
Sequence:CCGGGTACTCAGAACAGCCGATGATCTCGAGATCATCGGCTGTTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1293s1c1
Sequence:CCGGGTGAATGTCGATACTGCCAGACTCGAGTCTGGCAGTATCGACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014138.3-1258s1c1
Sequence:CCGGCCCATTAGGTGACAGAAGTCACTCGAGTGACTTCTGTCACCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks