EMAIL THIS PAGE TO A FRIEND

FAM156B

family with sequence similarity 156, member B

Synonyms: TMEM29B
Species: Human FAM156B(727866), domestic guinea pig Fam156b(100720105), naked mole-rat Fam156b(101705185)
Gene ID:
domestic guinea pig(100720105) family with sequence similarity 156, member B
naked mole-rat(101705185) family with sequence similarity 156, member B
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099684 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321078 predicted 1432
2 SASI_Hs02_00321079 predicted 983
3 SASI_Hs02_00321080 predicted 719
4 SASI_Hs02_00321081 predicted 1374
5 SASI_Hs02_00321082 predicted 479
6 SASI_Hs02_00321083 predicted 707
7 SASI_Hs02_00321084 predicted 670
8 SASI_Hs02_00321085 predicted 1267
9 SASI_Hs02_00321086 predicted 1094
10 SASI_Hs02_00321087 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099684
VALIDATED
FAM156B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 156, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-736s21c1
Sequence:CCGGTTCCGATGTGAATGTCGATACCTCGAGGTATCGACATTCACATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099684.1-469s21c1
Sequence:CCGGTACTCAGAACAGCCGATGATGCTCGAGCATCATCGGCTGTTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099684.1-1347s21c1
Sequence:CCGGTGTCAGTAAGAGATCACATGTCTCGAGACATGTGATCTCTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-713s21c1
Sequence:CCGGTAGGTGACAGAAGTCAGAATCCTCGAGGATTCTGACTTCTGTCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-761s21c1
Sequence:CCGGAGAGCCACAGGCCGAATCTTTCTCGAGAAAGATTCGGCCTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099684
VALIDATED
FAM156B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 156, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-736s21c1
Sequence:CCGGTTCCGATGTGAATGTCGATACCTCGAGGTATCGACATTCACATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099684.1-469s21c1
Sequence:CCGGTACTCAGAACAGCCGATGATGCTCGAGCATCATCGGCTGTTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099684.1-1347s21c1
Sequence:CCGGTGTCAGTAAGAGATCACATGTCTCGAGACATGTGATCTCTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-713s21c1
Sequence:CCGGTAGGTGACAGAAGTCAGAATCCTCGAGGATTCTGACTTCTGTCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-761s21c1
Sequence:CCGGAGAGCCACAGGCCGAATCTTTCTCGAGAAAGATTCGGCCTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099684
VALIDATED
FAM156B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 156, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-736s21c1
Sequence:CCGGTTCCGATGTGAATGTCGATACCTCGAGGTATCGACATTCACATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099684.1-469s21c1
Sequence:CCGGTACTCAGAACAGCCGATGATGCTCGAGCATCATCGGCTGTTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099684.1-1347s21c1
Sequence:CCGGTGTCAGTAAGAGATCACATGTCTCGAGACATGTGATCTCTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-713s21c1
Sequence:CCGGTAGGTGACAGAAGTCAGAATCCTCGAGGATTCTGACTTCTGTCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099684.1-761s21c1
Sequence:CCGGAGAGCCACAGGCCGAATCTTTCTCGAGAAAGATTCGGCCTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks