EMAIL THIS PAGE TO A FRIEND

FAM157A

family with sequence similarity 157, member A

22 Gene Product Result for
Species: Human FAM157A(728262)
UniProtKB ID: C9JC47
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145248 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127016 Rosetta Predictions human pricing
XM_001717356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383428 predicted 470
2 SASI_Hs02_00383429 predicted 445
3 SASI_Hs02_00383430 predicted 479
4 SASI_Hs02_00383431 predicted 446
5 SASI_Hs02_00383432 predicted 446
6 SASI_Hs02_00383433 predicted 475
7 SASI_Hs02_00383434 predicted 471
8 SASI_Hs02_00383435 predicted 1153
9 SASI_Hs02_00383436 predicted 321
10 SASI_Hs02_00383437 predicted 136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416734 predicted 463
2 SASI_Hs02_00416735 predicted 239
3 SASI_Hs02_00416736 predicted 201
4 SASI_Hs02_00416737 predicted 284
5 SASI_Hs02_00416738 predicted 240
6 SASI_Hs02_00416739 predicted 489
7 SASI_Hs02_00416740 predicted 278
8 SASI_Hs02_00416741 predicted 615
9 SASI_Hs02_00416742 predicted 487
10 SASI_Hs02_00416743 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145248
FAM157A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 157, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1049s21c1
Sequence:CCGGAGCACGAGGGTCGTGTTAACTCTCGAGAGTTAACACGACCCTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1096s21c1
Sequence:CCGGGTTATTGCTGTACCAGATTTGCTCGAGCAAATCTGGTACAGCAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-267s21c1
Sequence:CCGGTCACCAGAGGATCCAGATTTCCTCGAGGAAATCTGGATCCTCTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-874s21c1
Sequence:CCGGGCTGCCCGAGGAAAGGTATTTCTCGAGAAATACCTTTCCTCGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-179s21c1
Sequence:CCGGAGAAACCAAGTGAGGACATTTCTCGAGAAATGTCCTCACTTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145248
FAM157A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 157, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1049s21c1
Sequence:CCGGAGCACGAGGGTCGTGTTAACTCTCGAGAGTTAACACGACCCTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1096s21c1
Sequence:CCGGGTTATTGCTGTACCAGATTTGCTCGAGCAAATCTGGTACAGCAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-267s21c1
Sequence:CCGGTCACCAGAGGATCCAGATTTCCTCGAGGAAATCTGGATCCTCTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-874s21c1
Sequence:CCGGGCTGCCCGAGGAAAGGTATTTCTCGAGAAATACCTTTCCTCGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-179s21c1
Sequence:CCGGAGAAACCAAGTGAGGACATTTCTCGAGAAATGTCCTCACTTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145248
FAM157A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 157, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1049s21c1
Sequence:CCGGAGCACGAGGGTCGTGTTAACTCTCGAGAGTTAACACGACCCTCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-1096s21c1
Sequence:CCGGGTTATTGCTGTACCAGATTTGCTCGAGCAAATCTGGTACAGCAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-267s21c1
Sequence:CCGGTCACCAGAGGATCCAGATTTCCTCGAGGAAATCTGGATCCTCTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-874s21c1
Sequence:CCGGGCTGCCCGAGGAAAGGTATTTCTCGAGAAATACCTTTCCTCGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145248.1-179s21c1
Sequence:CCGGAGAAACCAAGTGAGGACATTTCTCGAGAAATGTCCTCACTTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)