EMAIL THIS PAGE TO A FRIEND

FAM157B

family with sequence similarity 157, member B

12 Gene Product Result for
Species: Human FAM157B(100132403)
UniProtKB ID: P0CG42
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145249 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715132 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401674 predicted 823
2 SASI_Hs02_00401675 predicted 447
3 SASI_Hs02_00401676 predicted 692
4 SASI_Hs02_00401677 predicted 487
5 SASI_Hs02_00401678 predicted 817
6 SASI_Hs02_00401679 predicted 488
7 SASI_Hs02_00401680 predicted 882
8 SASI_Hs02_00401681 predicted 484
9 SASI_Hs02_00401682 predicted 670
10 SASI_Hs02_00401683 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145249
FAM157B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 157, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1071s21c1
Sequence:CCGGTTTGGTGTTCTTCATTGATTCCTCGAGGAATCAATGAAGAACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-180s21c1
Sequence:CCGGGAAACCAAGTGAGGACATTTACTCGAGTAAATGTCCTCACTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-878s21c1
Sequence:CCGGCTGCCCGAGGAAAGGTATTTCCTCGAGGAAATACCTTTCCTCGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1098s21c1
Sequence:CCGGAGTTATTGCTGTACCAGATTTCTCGAGAAATCTGGTACAGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-269s21c1
Sequence:CCGGTTCACCAGAGGATCCAGATTTCTCGAGAAATCTGGATCCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145249
FAM157B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 157, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1071s21c1
Sequence:CCGGTTTGGTGTTCTTCATTGATTCCTCGAGGAATCAATGAAGAACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-180s21c1
Sequence:CCGGGAAACCAAGTGAGGACATTTACTCGAGTAAATGTCCTCACTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-878s21c1
Sequence:CCGGCTGCCCGAGGAAAGGTATTTCCTCGAGGAAATACCTTTCCTCGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1098s21c1
Sequence:CCGGAGTTATTGCTGTACCAGATTTCTCGAGAAATCTGGTACAGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-269s21c1
Sequence:CCGGTTCACCAGAGGATCCAGATTTCTCGAGAAATCTGGATCCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145249
FAM157B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 157, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1071s21c1
Sequence:CCGGTTTGGTGTTCTTCATTGATTCCTCGAGGAATCAATGAAGAACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-180s21c1
Sequence:CCGGGAAACCAAGTGAGGACATTTACTCGAGTAAATGTCCTCACTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-878s21c1
Sequence:CCGGCTGCCCGAGGAAAGGTATTTCCTCGAGGAAATACCTTTCCTCGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-1098s21c1
Sequence:CCGGAGTTATTGCTGTACCAGATTTCTCGAGAAATCTGGTACAGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145249.1-269s21c1
Sequence:CCGGTTCACCAGAGGATCCAGATTTCTCGAGAAATCTGGATCCTCTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks