EMAIL THIS PAGE TO A FRIEND

FAM159A

family with sequence similarity 159, member A

58 Gene Product Result for
Synonyms: PRO7171 WWLS2783
UniProtKB ID: Q6UWV7, Q6ZRG4
Gene ID:
Mouse(545667) family with sequence similarity 159, member A
Rat(689322) family with sequence similarity 159, member A
chicken(424644) family with sequence similarity 159, member A
dog(609737) family with sequence similarity 159, member A
domestic cat(101092282) family with sequence similarity 159, member A
cow(787024) family with sequence similarity 159, member A
naked mole-rat(101709150) family with sequence similarity 159, member A
sheep(101115930) family with sequence similarity 159, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057921 MISSION® esiRNA esiRNA human FAM159A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042693 Rosetta Predictions human pricing
NM_182621 Rosetta Predictions human pricing
XM_001070397 Rosetta Predictions rat pricing
NM_001099303 Rosetta Predictions mouse pricing
XM_620088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311005 predicted 462
2 SASI_Hs02_00311006 predicted 395
3 SASI_Hs02_00311007 predicted 393
4 SASI_Hs02_00311008 predicted 389
5 SASI_Hs02_00311009 predicted 408
6 SASI_Hs02_00311010 predicted 454
7 SASI_Hs02_00311011 predicted 431
8 SASI_Hs02_00311012 predicted 392
9 SASI_Hs02_00311013 predicted 459
10 SASI_Hs02_00311014 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170849 predicted 394
2 SASI_Hs01_00170850 predicted 714
3 SASI_Hs01_00170851 predicted 710
4 SASI_Hs01_00170852 predicted 721
5 SASI_Hs01_00170853 predicted 704
6 SASI_Hs01_00170854 predicted 665
7 SASI_Hs01_00170855 predicted 411
8 SASI_Hs01_00170856 predicted 585
9 SASI_Hs01_00170857 predicted 114
10 SASI_Hs01_00170858 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331508 predicted 210
2 SASI_Rn02_00331509 predicted 257
3 SASI_Rn02_00331510 predicted 240
4 SASI_Rn02_00331511 predicted 249
5 SASI_Rn02_00331512 predicted 264
6 SASI_Rn02_00331513 predicted 244
7 SASI_Rn02_00331514 predicted 207
8 SASI_Rn02_00331515 predicted 239
9 SASI_Rn02_00331516 predicted 240
10 SASI_Rn02_00331517 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301618 predicted 300
2 SASI_Mm02_00301619 predicted 213
3 SASI_Mm02_00301620 predicted 342
4 SASI_Mm02_00301621 predicted 305
5 SASI_Mm02_00301622 predicted 246
6 SASI_Mm02_00301623 predicted 200
7 SASI_Mm02_00301624 predicted 346
8 SASI_Mm02_00301625 predicted 258
9 SASI_Mm02_00301626 predicted 303
10 SASI_Mm02_00301627 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277817 predicted 328
2 SASI_Mm01_00277818 predicted 318
3 SASI_Mm01_00277819 predicted 374
4 SASI_Mm01_00277820 predicted 350
5 SASI_Mm01_00277821 predicted 468
6 SASI_Mm01_00277822 predicted 550
7 SASI_Mm01_00277823 predicted 385
8 SASI_Mm01_00277824 predicted 598
9 SASI_Mm01_00277825 predicted 325
10 SASI_Mm01_00277826 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042693
FAM159A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 159, member A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000418770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-279s21c1
Sequence:CCGGTCAGCATTGGCGCTCTCATAGCTCGAGCTATGAGAGCGCCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-444s21c1
Sequence:CCGGACTGCCAAGGTGTGAACACAGCTCGAGCTGTGTTCACACCTTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042693
FAM159A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 159, member A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000418770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-279s21c1
Sequence:CCGGTCAGCATTGGCGCTCTCATAGCTCGAGCTATGAGAGCGCCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-444s21c1
Sequence:CCGGACTGCCAAGGTGTGAACACAGCTCGAGCTGTGTTCACACCTTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042693
FAM159A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 159, member A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000418770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-279s21c1
Sequence:CCGGTCAGCATTGGCGCTCTCATAGCTCGAGCTATGAGAGCGCCAATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042693.1-444s21c1
Sequence:CCGGACTGCCAAGGTGTGAACACAGCTCGAGCTGTGTTCACACCTTGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099303
FAM159A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 159, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-419s21c1
Sequence:CCGGCCTCGAACACACATCTGGAAACTCGAGTTTCCAGATGTGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-305s21c1
Sequence:CCGGCCGGCTTAAGCTTGCAGACAACTCGAGTTGTCTGCAAGCTTAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-344s21c1
Sequence:CCGGCACCTGACCACCATGGTTTGACTCGAGTCAAACCATGGTGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-277s21c1
Sequence:CCGGAGCTCAAAGCCTCAGACCAAGCTCGAGCTTGGTCTGAGGCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-247s21c1
Sequence:CCGGACTGCCTGTGTGCTCTGTTACCTCGAGGTAACAGAGCACACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099303
FAM159A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 159, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-419s21c1
Sequence:CCGGCCTCGAACACACATCTGGAAACTCGAGTTTCCAGATGTGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-305s21c1
Sequence:CCGGCCGGCTTAAGCTTGCAGACAACTCGAGTTGTCTGCAAGCTTAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-344s21c1
Sequence:CCGGCACCTGACCACCATGGTTTGACTCGAGTCAAACCATGGTGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-277s21c1
Sequence:CCGGAGCTCAAAGCCTCAGACCAAGCTCGAGCTTGGTCTGAGGCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-247s21c1
Sequence:CCGGACTGCCTGTGTGCTCTGTTACCTCGAGGTAACAGAGCACACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099303
FAM159A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 159, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-419s21c1
Sequence:CCGGCCTCGAACACACATCTGGAAACTCGAGTTTCCAGATGTGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-305s21c1
Sequence:CCGGCCGGCTTAAGCTTGCAGACAACTCGAGTTGTCTGCAAGCTTAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-344s21c1
Sequence:CCGGCACCTGACCACCATGGTTTGACTCGAGTCAAACCATGGTGGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-277s21c1
Sequence:CCGGAGCTCAAAGCCTCAGACCAAGCTCGAGCTTGGTCTGAGGCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099303.1-247s21c1
Sequence:CCGGACTGCCTGTGTGCTCTGTTACCTCGAGGTAACAGAGCACACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182621
FAM159A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 159, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1675s1c1
Sequence:CCGGGCTACAGGCAAGAGGATACTACTCGAGTAGTATCCTCTTGCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-450s1c1
Sequence:CCGGGCTACCTGTTCATCAGCTCTACTCGAGTAGAGCTGATGAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-410s1c1
Sequence:CCGGGTGGTTCTTCTCGCCTTCATTCTCGAGAATGAAGGCGAGAAGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1432s1c1
Sequence:CCGGCCAGCAGCCAATTGGATCTTTCTCGAGAAAGATCCAATTGGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1658s1c1
Sequence:CCGGCCCTGAGATACAACTGAGCTACTCGAGTAGCTCAGTTGTATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182621.1-229s1c1
Sequence:CCGGCGACGACCCGCACAGCTTCTTCTCGAGAAGAAGCTGTGCGGGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-926s1c1
Sequence:CCGGCGAATGAGTGTATGGAGCAAACTCGAGTTTGCTCCATACACTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-804s1c1
Sequence:CCGGCACCATCATCATCATTGTCATCTCGAGATGACAATGATGATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182621
FAM159A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 159, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1675s1c1
Sequence:CCGGGCTACAGGCAAGAGGATACTACTCGAGTAGTATCCTCTTGCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-450s1c1
Sequence:CCGGGCTACCTGTTCATCAGCTCTACTCGAGTAGAGCTGATGAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-410s1c1
Sequence:CCGGGTGGTTCTTCTCGCCTTCATTCTCGAGAATGAAGGCGAGAAGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1432s1c1
Sequence:CCGGCCAGCAGCCAATTGGATCTTTCTCGAGAAAGATCCAATTGGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1658s1c1
Sequence:CCGGCCCTGAGATACAACTGAGCTACTCGAGTAGCTCAGTTGTATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182621.1-229s1c1
Sequence:CCGGCGACGACCCGCACAGCTTCTTCTCGAGAAGAAGCTGTGCGGGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-926s1c1
Sequence:CCGGCGAATGAGTGTATGGAGCAAACTCGAGTTTGCTCCATACACTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-804s1c1
Sequence:CCGGCACCATCATCATCATTGTCATCTCGAGATGACAATGATGATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182621
FAM159A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 159, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1675s1c1
Sequence:CCGGGCTACAGGCAAGAGGATACTACTCGAGTAGTATCCTCTTGCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-450s1c1
Sequence:CCGGGCTACCTGTTCATCAGCTCTACTCGAGTAGAGCTGATGAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-410s1c1
Sequence:CCGGGTGGTTCTTCTCGCCTTCATTCTCGAGAATGAAGGCGAGAAGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1432s1c1
Sequence:CCGGCCAGCAGCCAATTGGATCTTTCTCGAGAAAGATCCAATTGGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-1658s1c1
Sequence:CCGGCCCTGAGATACAACTGAGCTACTCGAGTAGCTCAGTTGTATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182621.1-229s1c1
Sequence:CCGGCGACGACCCGCACAGCTTCTTCTCGAGAAGAAGCTGTGCGGGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182621.1-926s1c1
Sequence:CCGGCGAATGAGTGTATGGAGCAAACTCGAGTTTGCTCCATACACTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182621.1-804s1c1
Sequence:CCGGCACCATCATCATCATTGTCATCTCGAGATGACAATGATGATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks