EMAIL THIS PAGE TO A FRIEND

FAM160A1

family with sequence similarity 160, member A1

84 Gene Product Result for
UniProtKB ID: Q05DH4, Q6ZUS2
Gene ID:
Mouse(229488) family with sequence similarity 160, member A1
Rat(365834) family with sequence similarity 160, member A1
Zebrafish(100000787) family with sequence similarity 160, member A1
cow(528939) family with sequence similarity 160, member A1
domestic cat(101101130) family with sequence similarity 160, member A1
dog(482649) family with sequence similarity 160, member A1
chicken(422479) family with sequence similarity 160, member A1
naked mole-rat(101714979) family with sequence similarity 160, member A1
domestic guinea pig(100731598) family with sequence similarity 160, member A1
sheep(101105280) family with sequence similarity 160, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014951 MISSION® esiRNA esiRNA targeting mouse Fam160a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109977 Rosetta Predictions human pricing
XM_001715912 Rosetta Predictions human pricing
XM_001715923 Rosetta Predictions human pricing
XM_001718535 Rosetta Predictions human pricing
NM_001134592 Rosetta Predictions rat pricing
XR_008824 Rosetta Predictions rat pricing
NM_172682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324823 predicted 2444
2 SASI_Hs02_00324824 predicted 3433
3 SASI_Hs02_00324825 predicted 3324
4 SASI_Hs02_00324826 predicted 2223
5 SASI_Hs02_00324827 predicted 1221
6 SASI_Hs02_00324828 predicted 1732
7 SASI_Hs02_00324829 predicted 2476
8 SASI_Hs02_00324830 predicted 1405
9 SASI_Hs02_00324831 predicted 1491
10 SASI_Hs02_00324832 predicted 2450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406944 predicted 2245
2 SASI_Hs02_00406945 predicted 3304
3 SASI_Hs02_00406946 predicted 3200
4 SASI_Hs02_00406947 predicted 2016
5 SASI_Hs02_00406948 predicted 1013
6 SASI_Hs02_00406949 predicted 1531
7 SASI_Hs02_00406950 predicted 2275
8 SASI_Hs02_00406951 predicted 2994
9 SASI_Hs02_00406952 predicted 1197
10 SASI_Hs02_00406953 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407004 predicted 2035
2 SASI_Hs02_00407005 predicted 3102
3 SASI_Hs02_00407006 predicted 2988
4 SASI_Hs02_00407007 predicted 1805
5 SASI_Hs02_00407008 predicted 806
6 SASI_Hs02_00407009 predicted 1318
7 SASI_Hs02_00407010 predicted 2058
8 SASI_Hs02_00407011 predicted 2789
9 SASI_Hs02_00407012 predicted 992
10 SASI_Hs02_00407013 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424575 predicted 1279
2 SASI_Hs02_00424576 predicted 2244
3 SASI_Hs02_00424577 predicted 3305
4 SASI_Hs02_00424578 predicted 3200
5 SASI_Hs02_00424579 predicted 2008
6 SASI_Hs02_00424580 predicted 1008
7 SASI_Hs02_00424581 predicted 1525
8 SASI_Hs02_00424582 predicted 2269
9 SASI_Hs02_00424583 predicted 1198
10 SASI_Hs02_00424584 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257399 predicted 2277
2 SASI_Rn02_00257400 predicted 2631
3 SASI_Rn02_00257401 predicted 2295
4 SASI_Rn02_00257402 predicted 2238
5 SASI_Rn02_00257403 predicted 651
6 SASI_Rn02_00257404 predicted 560
7 SASI_Rn02_00257405 predicted 1327
8 SASI_Rn02_00257406 predicted 585
9 SASI_Rn02_00257407 predicted 611
10 SASI_Rn02_00257408 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147154 predicted 3234
2 SASI_Rn01_00147155 predicted 385
3 SASI_Rn01_00147156 predicted 421
4 SASI_Rn01_00147157 predicted 707
5 SASI_Rn01_00147158 predicted 3251
6 SASI_Rn01_00147159 predicted 784
7 SASI_Rn01_00147160 predicted 332
8 SASI_Rn01_00147161 predicted 3128
9 SASI_Rn01_00147162 predicted 2963
10 SASI_Rn01_00147163 predicted 3429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344422 predicted 591
2 SASI_Mm02_00344423 predicted 301
3 SASI_Mm02_00344424 predicted 876
4 SASI_Mm01_00143014 predicted 1600
5 SASI_Mm01_00143015 predicted 1948
6 SASI_Mm01_00143016 predicted 1484
7 SASI_Mm02_00344425 predicted 722
8 SASI_Mm01_00143017 predicted 2562
9 SASI_Mm01_00143018 predicted 1434
10 SASI_Mm01_00143019 predicted 2155
11 SASI_Mm01_00143012 predicted 2430
12 SASI_Mm01_00143013 predicted 1625
13 SASI_Mm01_00143020 predicted 625
14 SASI_Mm01_00143021 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109977
FAM160A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1727s21c1
Sequence:CCGGTGTGGTGTCTCTGGCATTATTCTCGAGAATAATGCCAGAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109977.1-4010s21c1
Sequence:CCGGGATCACGTCAAGCAGATATTGCTCGAGCAATATCTGCTTGACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1940s21c1
Sequence:CCGGGAACCAAGAGAGGGATTATATCTCGAGATATAATCCCTCTCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-3193s21c1
Sequence:CCGGTGCTGCTTATCGGGATCATTACTCGAGTAATGATCCCGATAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-2835s21c1
Sequence:CCGGCAGTATGACCAAATCATTAAACTCGAGTTTAATGATTTGGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109977
FAM160A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1727s21c1
Sequence:CCGGTGTGGTGTCTCTGGCATTATTCTCGAGAATAATGCCAGAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109977.1-4010s21c1
Sequence:CCGGGATCACGTCAAGCAGATATTGCTCGAGCAATATCTGCTTGACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1940s21c1
Sequence:CCGGGAACCAAGAGAGGGATTATATCTCGAGATATAATCCCTCTCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-3193s21c1
Sequence:CCGGTGCTGCTTATCGGGATCATTACTCGAGTAATGATCCCGATAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-2835s21c1
Sequence:CCGGCAGTATGACCAAATCATTAAACTCGAGTTTAATGATTTGGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109977
FAM160A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1727s21c1
Sequence:CCGGTGTGGTGTCTCTGGCATTATTCTCGAGAATAATGCCAGAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109977.1-4010s21c1
Sequence:CCGGGATCACGTCAAGCAGATATTGCTCGAGCAATATCTGCTTGACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-1940s21c1
Sequence:CCGGGAACCAAGAGAGGGATTATATCTCGAGATATAATCCCTCTCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-3193s21c1
Sequence:CCGGTGCTGCTTATCGGGATCATTACTCGAGTAATGATCCCGATAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109977.1-2835s21c1
Sequence:CCGGCAGTATGACCAAATCATTAAACTCGAGTTTAATGATTTGGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172682
FAM160A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member A1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-144s1c1
Sequence:CCGGGCTCGTCAGCTACATTTACAACTCGAGTTGTAAATGTAGCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-2206s1c1
Sequence:CCGGGCACTCACCAAAGATCCCATTCTCGAGAATGGGATCTTTGGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172682.1-3048s1c1
Sequence:CCGGGCACACAGAGAGAATCTGGAACTCGAGTTCCAGATTCTCTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-1544s1c1
Sequence:CCGGCCTTAGCATTAGACTCGGAGTCTCGAGACTCCGAGTCTAATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1549s1c1
Sequence:CCGGGCATTAGACTCGGAGTTGATACTCGAGTATCAACTCCGAGTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1642s1c1
Sequence:CCGGCAGTACGACCAGATCATTCAACTCGAGTTGAATGATCTGGTCGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-424s1c1
Sequence:CCGGGAAGATGTGATGTTACAGCTACTCGAGTAGCTGTAACATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172682.1-2892s1c1
Sequence:CCGGGCAAGAAGTGAAATGTAAGAACTCGAGTTCTTACATTTCACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172682
FAM160A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member A1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-144s1c1
Sequence:CCGGGCTCGTCAGCTACATTTACAACTCGAGTTGTAAATGTAGCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-2206s1c1
Sequence:CCGGGCACTCACCAAAGATCCCATTCTCGAGAATGGGATCTTTGGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172682.1-3048s1c1
Sequence:CCGGGCACACAGAGAGAATCTGGAACTCGAGTTCCAGATTCTCTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-1544s1c1
Sequence:CCGGCCTTAGCATTAGACTCGGAGTCTCGAGACTCCGAGTCTAATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1549s1c1
Sequence:CCGGGCATTAGACTCGGAGTTGATACTCGAGTATCAACTCCGAGTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1642s1c1
Sequence:CCGGCAGTACGACCAGATCATTCAACTCGAGTTGAATGATCTGGTCGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-424s1c1
Sequence:CCGGGAAGATGTGATGTTACAGCTACTCGAGTAGCTGTAACATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172682.1-2892s1c1
Sequence:CCGGGCAAGAAGTGAAATGTAAGAACTCGAGTTCTTACATTTCACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172682
FAM160A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member A1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-144s1c1
Sequence:CCGGGCTCGTCAGCTACATTTACAACTCGAGTTGTAAATGTAGCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-2206s1c1
Sequence:CCGGGCACTCACCAAAGATCCCATTCTCGAGAATGGGATCTTTGGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172682.1-3048s1c1
Sequence:CCGGGCACACAGAGAGAATCTGGAACTCGAGTTCCAGATTCTCTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172682.1-1544s1c1
Sequence:CCGGCCTTAGCATTAGACTCGGAGTCTCGAGACTCCGAGTCTAATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1549s1c1
Sequence:CCGGGCATTAGACTCGGAGTTGATACTCGAGTATCAACTCCGAGTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-1642s1c1
Sequence:CCGGCAGTACGACCAGATCATTCAACTCGAGTTGAATGATCTGGTCGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172682.1-424s1c1
Sequence:CCGGGAAGATGTGATGTTACAGCTACTCGAGTAGCTGTAACATCACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172682.1-2892s1c1
Sequence:CCGGGCAAGAAGTGAAATGTAAGAACTCGAGTTCTTACATTTCACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks