EMAIL THIS PAGE TO A FRIEND

FAM160A2

family with sequence similarity 160, member A2

79 Gene Product Result for
Synonyms: C11orf56
UniProtKB ID: Q8N612, Q9C0A4, Q9H0N3, Q9H624
Gene ID:
Mouse(74349) family with sequence similarity 160, member A2
Rat(293343) family with sequence similarity 160, member A2
sheep(101118896) family with sequence similarity 160, member A2
domestic guinea pig(100735621) family with sequence similarity 160, member A2
naked mole-rat(101696838) family with sequence similarity 160, member A2
Zebrafish(100001896) family with sequence similarity 160, member A2
chicken(425130) family with sequence similarity 160, member A2
dog(485332) family with sequence similarity 160, member A2
cow(508334) family with sequence similarity 160, member A2
domestic cat(101089392) family with sequence similarity 160, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013991 MISSION® esiRNA esiRNA targeting human FAM160A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098794 Rosetta Predictions human pricing
NM_032127 Rosetta Predictions human pricing
NM_001005538 Rosetta Predictions rat pricing
NM_199009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319859 predicted 872
2 SASI_Hs02_00319860 predicted 1321
3 SASI_Hs02_00319861 predicted 747
4 SASI_Hs02_00319862 predicted 2614
5 SASI_Hs02_00319863 predicted 2835
6 SASI_Hs02_00319864 predicted 3128
7 SASI_Hs02_00319865 predicted 367
8 SASI_Hs02_00319866 predicted 575
9 SASI_Hs02_00319867 predicted 1153
10 SASI_Hs02_00319868 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359340 predicted 871
2 SASI_Hs01_00051159 predicted 1313
3 SASI_Hs02_00359341 predicted 746
4 SASI_Hs01_00051161 predicted 2657
5 SASI_Hs01_00051162 predicted 2878
6 SASI_Hs01_00051163 predicted 3164
7 SASI_Hs02_00359342 predicted 367
8 SASI_Hs01_00051164 predicted 570
9 SASI_Hs01_00051165 predicted 1160
10 SASI_Hs01_00051166 predicted 1096
11 SASI_Hs01_00051158 predicted 682
12 SASI_Hs01_00051160 predicted 1561
13 SASI_Hs01_00051167 predicted 2745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111896 predicted 1854
2 SASI_Rn01_00111897 predicted 3156
3 SASI_Rn01_00111898 predicted 2623
4 SASI_Rn01_00111899 predicted 492
5 SASI_Rn02_00198392 predicted 2330
6 SASI_Rn01_00111901 predicted 3131
7 SASI_Rn01_00111903 predicted 2733
8 SASI_Rn01_00111904 predicted 2764
9 SASI_Rn01_00111905 predicted 518
10 SASI_Rn02_00198393 predicted 2125
11 SASI_Rn01_00111900 predicted 594
12 SASI_Rn01_00111902 predicted 2526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094773 predicted 710
2 SASI_Mm01_00094774 predicted 614
3 SASI_Mm01_00094775 predicted 2101
4 SASI_Mm01_00094776 predicted 2092
5 SASI_Mm01_00094777 predicted 2587
6 SASI_Mm01_00094778 predicted 1285
7 SASI_Mm01_00094779 predicted 1407
8 SASI_Mm01_00094780 predicted 2293
9 SASI_Mm02_00351261 predicted 404
10 SASI_Mm01_00094781 predicted 1612
11 SASI_Mm01_00094782 predicted 2743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032127
VALIDATED
FAM160A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-992s1c1
Sequence:CCGGCCTACTTCTTCTCATGGCTTTCTCGAGAAAGCCATGAGAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-675s1c1
Sequence:CCGGGCTGAGCAACTGAAACTATTTCTCGAGAAATAGTTTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-503s1c1
Sequence:CCGGCAACCACACTTACCAGATGTTCTCGAGAACATCTGGTAAGTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-1180s1c1
Sequence:CCGGCCCTTGCACTCTTCATGAGTTCTCGAGAACTCATGAAGAGTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-2597s1c1
Sequence:CCGGGAACTCCGTCTATGTCAACTTCTCGAGAAGTTGACATAGACGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032127
VALIDATED
FAM160A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-992s1c1
Sequence:CCGGCCTACTTCTTCTCATGGCTTTCTCGAGAAAGCCATGAGAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-675s1c1
Sequence:CCGGGCTGAGCAACTGAAACTATTTCTCGAGAAATAGTTTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-503s1c1
Sequence:CCGGCAACCACACTTACCAGATGTTCTCGAGAACATCTGGTAAGTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-1180s1c1
Sequence:CCGGCCCTTGCACTCTTCATGAGTTCTCGAGAACTCATGAAGAGTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-2597s1c1
Sequence:CCGGGAACTCCGTCTATGTCAACTTCTCGAGAAGTTGACATAGACGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032127
VALIDATED
FAM160A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-992s1c1
Sequence:CCGGCCTACTTCTTCTCATGGCTTTCTCGAGAAAGCCATGAGAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-675s1c1
Sequence:CCGGGCTGAGCAACTGAAACTATTTCTCGAGAAATAGTTTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-503s1c1
Sequence:CCGGCAACCACACTTACCAGATGTTCTCGAGAACATCTGGTAAGTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032127.1-1180s1c1
Sequence:CCGGCCCTTGCACTCTTCATGAGTTCTCGAGAACTCATGAAGAGTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032127.1-2597s1c1
Sequence:CCGGGAACTCCGTCTATGTCAACTTCTCGAGAAGTTGACATAGACGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199009
VALIDATED
FAM160A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member A2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199009.1-3177s1c1
Sequence:CCGGCGCCTTTCTTGTTGGATACTTCTCGAGAAGTATCCAACAAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1964s1c1
Sequence:CCGGGAAGACAATTACCTGGAGTATCTCGAGATACTCCAGGTAATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1285s1c1
Sequence:CCGGGCTGGTTGATTATATTCACAACTCGAGTTGTGAATATAATCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-704s1c1
Sequence:CCGGGCTGAACAGTTGAAACTATTTCTCGAGAAATAGTTTCAACTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-2093s1c1
Sequence:CCGGCGGACTAAGAAACGCAGTCTACTCGAGTAGACTGCGTTTCTTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-3174s1c1
Sequence:CCGGCCTCGCCTTTCTTGTTGGATACTCGAGTATCCAACAAGAAAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199009
VALIDATED
FAM160A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member A2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199009.1-3177s1c1
Sequence:CCGGCGCCTTTCTTGTTGGATACTTCTCGAGAAGTATCCAACAAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1964s1c1
Sequence:CCGGGAAGACAATTACCTGGAGTATCTCGAGATACTCCAGGTAATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1285s1c1
Sequence:CCGGGCTGGTTGATTATATTCACAACTCGAGTTGTGAATATAATCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-704s1c1
Sequence:CCGGGCTGAACAGTTGAAACTATTTCTCGAGAAATAGTTTCAACTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-2093s1c1
Sequence:CCGGCGGACTAAGAAACGCAGTCTACTCGAGTAGACTGCGTTTCTTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-3174s1c1
Sequence:CCGGCCTCGCCTTTCTTGTTGGATACTCGAGTATCCAACAAGAAAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199009
VALIDATED
FAM160A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member A2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199009.1-3177s1c1
Sequence:CCGGCGCCTTTCTTGTTGGATACTTCTCGAGAAGTATCCAACAAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1964s1c1
Sequence:CCGGGAAGACAATTACCTGGAGTATCTCGAGATACTCCAGGTAATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-1285s1c1
Sequence:CCGGGCTGGTTGATTATATTCACAACTCGAGTTGTGAATATAATCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-704s1c1
Sequence:CCGGGCTGAACAGTTGAAACTATTTCTCGAGAAATAGTTTCAACTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-2093s1c1
Sequence:CCGGCGGACTAAGAAACGCAGTCTACTCGAGTAGACTGCGTTTCTTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199009.1-3174s1c1
Sequence:CCGGCCTCGCCTTTCTTGTTGGATACTCGAGTATCCAACAAGAAAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks