EMAIL THIS PAGE TO A FRIEND

FAM160B1

family with sequence similarity 160, member B1

203 Gene Product Result for
Synonyms: KIAA1600 bA106M7.3
UniProtKB ID: Q5W0V3, Q5H9P7, Q5W0V2, Q8IY76, Q9HCH2
Gene ID:
Mouse(226252) family with sequence similarity 160, member B1
Rat(361774) family with sequence similarity 160, member B1
Zebrafish(100038786) family with sequence similarity 160, member B1
chicken(423912) family with sequence similarity 160, member B1
cow(522276) family with sequence similarity 160, member B1
domestic cat(101082440) family with sequence similarity 160, member B1
dog(486899) family with sequence similarity 160, member B1
naked mole-rat(101702253) family with sequence similarity 160, member B1
domestic guinea pig(100713487) family with sequence similarity 160, member B1
sheep(101119353) family with sequence similarity 160, member B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020940 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020940 Rosetta Predictions human pricing
XM_001064355 Rosetta Predictions rat pricing
XM_342068 Rosetta Predictions rat pricing
NM_145505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183696 predicted 1248
2 SASI_Hs01_00183697 predicted 2020
3 SASI_Hs01_00183698 predicted 339
4 SASI_Hs01_00183699 predicted 2125
5 SASI_Hs02_00354333 predicted 2106
6 SASI_Hs02_00354334 predicted 734
7 SASI_Hs02_00354335 predicted 935
8 SASI_Hs01_00183700 predicted 1397
9 SASI_Hs01_00183701 predicted 1224
10 SASI_Hs01_00183702 predicted 1860
11 SASI_Hs01_00183695 predicted 1627
12 SASI_Hs01_00183703 predicted 1586
13 SASI_Hs01_00183704 predicted 2002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310151 predicted 2580
2 SASI_Rn02_00310152 predicted 2313
3 SASI_Rn02_00310153 predicted 2096
4 SASI_Rn02_00310154 predicted 971
5 SASI_Rn02_00310155 predicted 2067
6 SASI_Rn02_00310156 predicted 1134
7 SASI_Rn02_00310157 predicted 1813
8 SASI_Rn02_00310158 predicted 2199
9 SASI_Rn02_00310159 predicted 1478
10 SASI_Rn02_00310160 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393714 predicted 2519
2 SASI_Rn02_00393715 predicted 2260
3 SASI_Rn02_00393716 predicted 2039
4 SASI_Rn02_00393717 predicted 920
5 SASI_Rn02_00393718 predicted 2002
6 SASI_Rn02_00393719 predicted 1079
7 SASI_Rn02_00393720 predicted 1755
8 SASI_Rn02_00393721 predicted 2136
9 SASI_Rn02_00393722 predicted 1416
10 SASI_Rn02_00393723 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113460 predicted 1088
2 SASI_Mm01_00113461 predicted 734
3 SASI_Mm01_00113462 predicted 2677
4 SASI_Mm01_00113463 predicted 1670
5 SASI_Mm01_00113464 predicted 1422
6 SASI_Mm02_00340949 predicted 2530
7 SASI_Mm01_00113465 predicted 1892
8 SASI_Mm01_00113467 predicted 879
9 SASI_Mm01_00113468 predicted 578
10 SASI_Mm01_00113469 predicted 2499
11 SASI_Mm01_00113466 predicted 2037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020940
VALIDATED
FAM160B1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member B1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-803s1c1
Sequence:CCGGGCCTCGGTTGTTTGTCCAAATCTCGAGATTTGGACAAACAACCGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020940.2-684s1c1
Sequence:CCGGCAGAGGAACTATCTGGTGCTACTCGAGTAGCACCAGATAGTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-142s1c1
Sequence:CCGGCTGGAAGGCAATTACCCATTACTCGAGTAATGGGTAATTGCCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4623s1c1
Sequence:CCGGGCACCGTCATAACAATTGATTCTCGAGAATCAATTGTTATGACGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020940.2-3609s1c1
Sequence:CCGGCCGCAGCACTTTCTTCTTCATCTCGAGATGAAGAAGAAAGTGCTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-1373s1c1
Sequence:CCGGGAACCAGAAACTCTGGCAGAACTCGAGTTCTGCCAGAGTTTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-3723s1c1
Sequence:CCGGGCATGTTTGCATATACGCATTCTCGAGAATGCGTATATGCAAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020940.2-357s1c1
Sequence:CCGGCGGGAATGAAACAGCAGGTTTCTCGAGAAACCTGCTGTTTCATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4803s1c1
Sequence:CCGGGCCATATAGTACTCACCTTATCTCGAGATAAGGTGAGTACTATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1907s21c1
Sequence:CCGGTCTGGAAGAAGATCCATTATTCTCGAGAATAATGGATCTTCTTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1686s21c1
Sequence:CCGGCCTTTAAGGCATAGGTTAATTCTCGAGAATTAACCTATGCCTTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020940.3-2510s21c1
Sequence:CCGGGGAACCTGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCAGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1350s21c1
Sequence:CCGGTTGGACTCATATAGTCATAAACTCGAGTTTATGACTATATGAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2941s21c1
Sequence:CCGGGTCATGACTTTGATGATATTTCTCGAGAAATATCATCAAAGTCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2615s21c1
Sequence:CCGGTGCTTCCTCCACACCATAAATCTCGAGATTTATGGTGTGGAGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020940
VALIDATED
FAM160B1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member B1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-803s1c1
Sequence:CCGGGCCTCGGTTGTTTGTCCAAATCTCGAGATTTGGACAAACAACCGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020940.2-684s1c1
Sequence:CCGGCAGAGGAACTATCTGGTGCTACTCGAGTAGCACCAGATAGTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-142s1c1
Sequence:CCGGCTGGAAGGCAATTACCCATTACTCGAGTAATGGGTAATTGCCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4623s1c1
Sequence:CCGGGCACCGTCATAACAATTGATTCTCGAGAATCAATTGTTATGACGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020940.2-3609s1c1
Sequence:CCGGCCGCAGCACTTTCTTCTTCATCTCGAGATGAAGAAGAAAGTGCTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-1373s1c1
Sequence:CCGGGAACCAGAAACTCTGGCAGAACTCGAGTTCTGCCAGAGTTTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-3723s1c1
Sequence:CCGGGCATGTTTGCATATACGCATTCTCGAGAATGCGTATATGCAAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020940.2-357s1c1
Sequence:CCGGCGGGAATGAAACAGCAGGTTTCTCGAGAAACCTGCTGTTTCATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4803s1c1
Sequence:CCGGGCCATATAGTACTCACCTTATCTCGAGATAAGGTGAGTACTATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1907s21c1
Sequence:CCGGTCTGGAAGAAGATCCATTATTCTCGAGAATAATGGATCTTCTTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1686s21c1
Sequence:CCGGCCTTTAAGGCATAGGTTAATTCTCGAGAATTAACCTATGCCTTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020940.3-2510s21c1
Sequence:CCGGGGAACCTGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCAGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1350s21c1
Sequence:CCGGTTGGACTCATATAGTCATAAACTCGAGTTTATGACTATATGAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2941s21c1
Sequence:CCGGGTCATGACTTTGATGATATTTCTCGAGAAATATCATCAAAGTCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2615s21c1
Sequence:CCGGTGCTTCCTCCACACCATAAATCTCGAGATTTATGGTGTGGAGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020940
VALIDATED
FAM160B1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member B1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-803s1c1
Sequence:CCGGGCCTCGGTTGTTTGTCCAAATCTCGAGATTTGGACAAACAACCGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020940.2-684s1c1
Sequence:CCGGCAGAGGAACTATCTGGTGCTACTCGAGTAGCACCAGATAGTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-142s1c1
Sequence:CCGGCTGGAAGGCAATTACCCATTACTCGAGTAATGGGTAATTGCCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4623s1c1
Sequence:CCGGGCACCGTCATAACAATTGATTCTCGAGAATCAATTGTTATGACGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020940.2-3609s1c1
Sequence:CCGGCCGCAGCACTTTCTTCTTCATCTCGAGATGAAGAAGAAAGTGCTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020940.2-1373s1c1
Sequence:CCGGGAACCAGAAACTCTGGCAGAACTCGAGTTCTGCCAGAGTTTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020940.2-3723s1c1
Sequence:CCGGGCATGTTTGCATATACGCATTCTCGAGAATGCGTATATGCAAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020940.2-357s1c1
Sequence:CCGGCGGGAATGAAACAGCAGGTTTCTCGAGAAACCTGCTGTTTCATTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020940.2-4803s1c1
Sequence:CCGGGCCATATAGTACTCACCTTATCTCGAGATAAGGTGAGTACTATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1907s21c1
Sequence:CCGGTCTGGAAGAAGATCCATTATTCTCGAGAATAATGGATCTTCTTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1686s21c1
Sequence:CCGGCCTTTAAGGCATAGGTTAATTCTCGAGAATTAACCTATGCCTTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020940.3-2510s21c1
Sequence:CCGGGGAACCTGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCAGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-1350s21c1
Sequence:CCGGTTGGACTCATATAGTCATAAACTCGAGTTTATGACTATATGAGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2941s21c1
Sequence:CCGGGTCATGACTTTGATGATATTTCTCGAGAAATATCATCAAAGTCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020940.3-2615s21c1
Sequence:CCGGTGCTTCCTCCACACCATAAATCTCGAGATTTATGGTGTGGAGGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145505
VALIDATED
FAM160B1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member B1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-1415s1c1
Sequence:CCGGCCAGGACTACAACTTAGTGAACTCGAGTTCACTAAGTTGTAGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-2220s1c1
Sequence:CCGGCTGGAGGAAGATCCATTATTTCTCGAGAAATAATGGATCTTCCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-2908s1c1
Sequence:CCGGCCTTTGTTAAGTACCACGCTTCTCGAGAAGCGTGGTACTTAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1140s1c1
Sequence:CCGGGATCCCTACTTGGTCAACTTTCTCGAGAAAGTTGACCAAGTAGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-741s1c1
Sequence:CCGGGCGATTACACACTACTACATACTCGAGTATGTAGTAGTGTGTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1967s1c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-2933s21c1
Sequence:CCGGTGGGACTCGAATGCTTATATTCTCGAGAATATAAGCATTCGAGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-571s21c1
Sequence:CCGGACAAGATCTTGGAAACGTTATCTCGAGATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-572s1c1
Sequence:CCGGCAAGATCTTGGAAACGTTATACTCGAGTATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-1668s1c1
Sequence:CCGGCCTCTAAGACATAGGTTAATCCTCGAGGATTAACCTATGTCTTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1637s21c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-1889s21c1
Sequence:CCGGTCTGGAGGAAGATCCATTATTCTCGAGAATAATGGATCTTCCTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-3006s21c1
Sequence:CCGGAGGTTAAGATTCTTATCATACCTCGAGGTATGATAAGAATCTTAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1687s21c1
Sequence:CCGGTCGAACATTGCGATCACATATCTCGAGATATGTGATCGCAATGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145505
VALIDATED
FAM160B1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member B1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-1415s1c1
Sequence:CCGGCCAGGACTACAACTTAGTGAACTCGAGTTCACTAAGTTGTAGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-2220s1c1
Sequence:CCGGCTGGAGGAAGATCCATTATTTCTCGAGAAATAATGGATCTTCCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-2908s1c1
Sequence:CCGGCCTTTGTTAAGTACCACGCTTCTCGAGAAGCGTGGTACTTAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1140s1c1
Sequence:CCGGGATCCCTACTTGGTCAACTTTCTCGAGAAAGTTGACCAAGTAGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-741s1c1
Sequence:CCGGGCGATTACACACTACTACATACTCGAGTATGTAGTAGTGTGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1967s1c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-2933s21c1
Sequence:CCGGTGGGACTCGAATGCTTATATTCTCGAGAATATAAGCATTCGAGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-571s21c1
Sequence:CCGGACAAGATCTTGGAAACGTTATCTCGAGATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-572s1c1
Sequence:CCGGCAAGATCTTGGAAACGTTATACTCGAGTATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-1668s1c1
Sequence:CCGGCCTCTAAGACATAGGTTAATCCTCGAGGATTAACCTATGTCTTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1637s21c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-1889s21c1
Sequence:CCGGTCTGGAGGAAGATCCATTATTCTCGAGAATAATGGATCTTCCTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-3006s21c1
Sequence:CCGGAGGTTAAGATTCTTATCATACCTCGAGGTATGATAAGAATCTTAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1687s21c1
Sequence:CCGGTCGAACATTGCGATCACATATCTCGAGATATGTGATCGCAATGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145505
VALIDATED
FAM160B1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member B1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-1415s1c1
Sequence:CCGGCCAGGACTACAACTTAGTGAACTCGAGTTCACTAAGTTGTAGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.2-2220s1c1
Sequence:CCGGCTGGAGGAAGATCCATTATTTCTCGAGAAATAATGGATCTTCCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-2908s1c1
Sequence:CCGGCCTTTGTTAAGTACCACGCTTCTCGAGAAGCGTGGTACTTAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1140s1c1
Sequence:CCGGGATCCCTACTTGGTCAACTTTCTCGAGAAAGTTGACCAAGTAGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-741s1c1
Sequence:CCGGGCGATTACACACTACTACATACTCGAGTATGTAGTAGTGTGTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145505.2-1967s1c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-2933s21c1
Sequence:CCGGTGGGACTCGAATGCTTATATTCTCGAGAATATAAGCATTCGAGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-571s21c1
Sequence:CCGGACAAGATCTTGGAAACGTTATCTCGAGATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-572s1c1
Sequence:CCGGCAAGATCTTGGAAACGTTATACTCGAGTATAACGTTTCCAAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145505.4-1668s1c1
Sequence:CCGGCCTCTAAGACATAGGTTAATCCTCGAGGATTAACCTATGTCTTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1637s21c1
Sequence:CCGGGCCAGAAACTCTGTCAGAAATCTCGAGATTTCTGACAGAGTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-1889s21c1
Sequence:CCGGTCTGGAGGAAGATCCATTATTCTCGAGAATAATGGATCTTCCTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145505.4-3006s21c1
Sequence:CCGGAGGTTAAGATTCTTATCATACCTCGAGGTATGATAAGAATCTTAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145505.4-1687s21c1
Sequence:CCGGTCGAACATTGCGATCACATATCTCGAGATATGTGATCGCAATGTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)