EMAIL THIS PAGE TO A FRIEND

FAM160B2

family with sequence similarity 160, member B2

143 Gene Product Result for
Synonyms: RAI16
Gene ID:
Mouse(239170) family with sequence similarity 160, member B2
Rat(306015) family with sequence similarity 160, member B2
sheep(101122842) family with sequence similarity 160, member B2
domestic guinea pig(100727632) family with sequence similarity 160, member B2
naked mole-rat(101709611) family with sequence similarity 160, member B2
Zebrafish(777718) family with sequence similarity 160, member B2
cow(507256) family with sequence similarity 160, member B2
domestic cat(101093849) family with sequence similarity 160, member B2
dog(486131) family with sequence similarity 160, member B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022749 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086891 MISSION® esiRNA esiRNA human FAM160B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022749 Rosetta Predictions human pricing
XM_001070016 Rosetta Predictions rat pricing
XM_224339 Rosetta Predictions rat pricing
XM_001480783 Rosetta Predictions mouse pricing
XM_139129 Rosetta Predictions mouse pricing
XM_914171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055112 predicted 1570
2 SASI_Hs01_00055114 predicted 974
3 SASI_Hs01_00055115 predicted 1741
4 SASI_Hs01_00055116 predicted 1829
5 SASI_Hs01_00055118 predicted 1902
6 SASI_Hs01_00055119 predicted 230
7 SASI_Hs02_00356004 predicted 1067
8 SASI_Hs01_00055120 predicted 1727
9 SASI_Hs01_00055121 predicted 510
10 SASI_Hs02_00356005 predicted 2018
11 SASI_Hs01_00055113 predicted 2410
12 SASI_Hs01_00055117 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330103 predicted 1077
2 SASI_Rn02_00330104 predicted 1819
3 SASI_Rn02_00330105 predicted 1999
4 SASI_Rn02_00330106 predicted 1253
5 SASI_Rn02_00330107 predicted 608
6 SASI_Rn02_00330108 predicted 655
7 SASI_Rn02_00330109 predicted 801
8 SASI_Rn02_00330110 predicted 1004
9 SASI_Rn02_00330111 predicted 1018
10 SASI_Rn02_00330112 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381919 predicted 1082
2 SASI_Rn02_00381920 predicted 1819
3 SASI_Rn02_00381921 predicted 2002
4 SASI_Rn02_00381922 predicted 1256
5 SASI_Rn02_00381923 predicted 609
6 SASI_Rn02_00381924 predicted 660
7 SASI_Rn02_00381925 predicted 797
8 SASI_Rn02_00381926 predicted 1002
9 SASI_Rn02_00381927 predicted 1015
10 SASI_Rn02_00381928 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00419763 predicted 606
2 SASI_Mm02_00419764 predicted 551
3 SASI_Mm02_00419765 predicted 358
4 SASI_Mm02_00419766 predicted 975
5 SASI_Mm02_00419767 predicted 1345
6 SASI_Mm02_00419768 predicted 917
7 SASI_Mm02_00419769 predicted 2297
8 SASI_Mm02_00419770 predicted 2301
9 SASI_Mm02_00419771 predicted 2169
10 SASI_Mm02_00419772 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227287 predicted 787
2 SASI_Mm01_00227288 predicted 738
3 SASI_Mm01_00227289 predicted 537
4 SASI_Mm01_00227290 predicted 1162
5 SASI_Mm01_00227291 predicted 1329
6 SASI_Mm01_00227292 predicted 1690
7 SASI_Mm01_00227293 predicted 1531
8 SASI_Mm01_00227294 predicted 1093
9 SASI_Mm01_00227295 predicted 2475
10 SASI_Mm01_00227296 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438356 predicted 608
2 SASI_Mm02_00438357 predicted 551
3 SASI_Mm02_00438358 predicted 362
4 SASI_Mm02_00438359 predicted 981
5 SASI_Mm02_00438360 predicted 1343
6 SASI_Mm02_00438361 predicted 908
7 SASI_Mm02_00438362 predicted 2306
8 SASI_Mm02_00438363 predicted 2304
9 SASI_Mm02_00438364 predicted 2175
10 SASI_Mm02_00438365 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194345
FAM160B2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member B2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1401s21c1
Sequence:CCGGTTGCCACGCTGAGGCTATTTGCTCGAGCAAATAGCCTCAGCGTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-980s21c1
Sequence:CCGGCCAGCAGACATTGCCACTTTACTCGAGTAAAGTGGCAATGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1710s21c1
Sequence:CCGGTCCTGGAGGAGAATGGATATGCTCGAGCATATCCATTCTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-142s21c1
Sequence:CCGGAGGCATCACACACTACTATATCTCGAGATATAGTAGTGTGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-611s21c1
Sequence:CCGGGAGTCTACAGCTCCGCCTAAACTCGAGTTTAGGCGGAGCTGTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194345.1-2534s21c1
Sequence:CCGGGTGACTATCTCTGCTATATTGCTCGAGCAATATAGCAGAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-549s21c1
Sequence:CCGGCAGAGCTGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1645s21c1
Sequence:CCGGAGCAGTGACGGAGATTGTTAACTCGAGTTAACAATCTCCGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194345
FAM160B2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member B2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1401s21c1
Sequence:CCGGTTGCCACGCTGAGGCTATTTGCTCGAGCAAATAGCCTCAGCGTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-980s21c1
Sequence:CCGGCCAGCAGACATTGCCACTTTACTCGAGTAAAGTGGCAATGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1710s21c1
Sequence:CCGGTCCTGGAGGAGAATGGATATGCTCGAGCATATCCATTCTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-142s21c1
Sequence:CCGGAGGCATCACACACTACTATATCTCGAGATATAGTAGTGTGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-611s21c1
Sequence:CCGGGAGTCTACAGCTCCGCCTAAACTCGAGTTTAGGCGGAGCTGTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194345.1-2534s21c1
Sequence:CCGGGTGACTATCTCTGCTATATTGCTCGAGCAATATAGCAGAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-549s21c1
Sequence:CCGGCAGAGCTGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1645s21c1
Sequence:CCGGAGCAGTGACGGAGATTGTTAACTCGAGTTAACAATCTCCGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194345
FAM160B2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member B2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1401s21c1
Sequence:CCGGTTGCCACGCTGAGGCTATTTGCTCGAGCAAATAGCCTCAGCGTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-980s21c1
Sequence:CCGGCCAGCAGACATTGCCACTTTACTCGAGTAAAGTGGCAATGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1710s21c1
Sequence:CCGGTCCTGGAGGAGAATGGATATGCTCGAGCATATCCATTCTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-142s21c1
Sequence:CCGGAGGCATCACACACTACTATATCTCGAGATATAGTAGTGTGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-611s21c1
Sequence:CCGGGAGTCTACAGCTCCGCCTAAACTCGAGTTTAGGCGGAGCTGTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194345.1-2534s21c1
Sequence:CCGGGTGACTATCTCTGCTATATTGCTCGAGCAATATAGCAGAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-549s21c1
Sequence:CCGGCAGAGCTGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194345.1-1645s21c1
Sequence:CCGGAGCAGTGACGGAGATTGTTAACTCGAGTTAACAATCTCCGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022749
VALIDATED
FAM160B2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 160, member B2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-162s21c1
Sequence:CCGGCATCGAGAGCACAGATGAAAGCTCGAGCTTTCATCTGTGCTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-1733s21c1
Sequence:CCGGCATACGTCCACGATGCTTATGCTCGAGCATAAGCATCGTGGACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-2704s21c1
Sequence:CCGGAGCCTTGTCTGTGTCACATTACTCGAGTAATGTGACACAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-1612s21c1
Sequence:CCGGCTAGCTCCTGCTACCAGTTACCTCGAGGTAACTGGTAGCAGGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-770s21c1
Sequence:CCGGCCACAGAGAGCAACCTGATTACTCGAGTAATCAGGTTGCTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022749.4-3599s1c1
Sequence:CCGGCGTCTGGACTCTTAGATTCATCTCGAGATGAATCTAAGAGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022749
VALIDATED
FAM160B2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 160, member B2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-162s21c1
Sequence:CCGGCATCGAGAGCACAGATGAAAGCTCGAGCTTTCATCTGTGCTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-1733s21c1
Sequence:CCGGCATACGTCCACGATGCTTATGCTCGAGCATAAGCATCGTGGACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-2704s21c1
Sequence:CCGGAGCCTTGTCTGTGTCACATTACTCGAGTAATGTGACACAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-1612s21c1
Sequence:CCGGCTAGCTCCTGCTACCAGTTACCTCGAGGTAACTGGTAGCAGGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-770s21c1
Sequence:CCGGCCACAGAGAGCAACCTGATTACTCGAGTAATCAGGTTGCTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022749.4-3599s1c1
Sequence:CCGGCGTCTGGACTCTTAGATTCATCTCGAGATGAATCTAAGAGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022749
VALIDATED
FAM160B2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 160, member B2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-162s21c1
Sequence:CCGGCATCGAGAGCACAGATGAAAGCTCGAGCTTTCATCTGTGCTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022749.5-1733s21c1
Sequence:CCGGCATACGTCCACGATGCTTATGCTCGAGCATAAGCATCGTGGACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-2704s21c1
Sequence:CCGGAGCCTTGTCTGTGTCACATTACTCGAGTAATGTGACACAGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-1612s21c1
Sequence:CCGGCTAGCTCCTGCTACCAGTTACCTCGAGGTAACTGGTAGCAGGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022749.5-770s21c1
Sequence:CCGGCCACAGAGAGCAACCTGATTACTCGAGTAATCAGGTTGCTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022749.4-3599s1c1
Sequence:CCGGCGTCTGGACTCTTAGATTCATCTCGAGATGAATCTAAGAGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks