EMAIL THIS PAGE TO A FRIEND

FAM161A

family with sequence similarity 161, member A

55 Gene Product Result for
Synonyms: RP28
UniProtKB ID: Q3B820, B4DJV7, Q9H8R2
Gene ID:
Human(84140) Summary: This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
Mouse(73873) family with sequence similarity 161, member A
Rat(289833) family with sequence similarity 161, member A
chicken(769188) family with sequence similarity 161, member A
domestic cat(101100801) family with sequence similarity 161, member A
cow(532883) family with sequence similarity 161, member A
dog(481385) family with sequence similarity 161, member A
naked mole-rat(101722868) family with sequence similarity 161, member A
domestic guinea pig(100732279) family with sequence similarity 161, member A
sheep(101117915) family with sequence similarity 161, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032180 Rosetta Predictions human pricing
NM_001013876 Rosetta Predictions rat pricing
NM_028672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046628 predicted 621
2 SASI_Hs01_00046629 predicted 885
3 SASI_Hs02_00359449 predicted 282
4 SASI_Hs01_00046631 predicted 1546
5 SASI_Hs01_00046633 predicted 950
6 SASI_Hs01_00046634 predicted 1177
7 SASI_Hs01_00046635 predicted 1332
8 SASI_Hs01_00046636 predicted 1188
9 SASI_Hs01_00046637 predicted 467
10 SASI_Hs02_00359450 predicted 662
11 SASI_Hs01_00046630 predicted 1373
12 SASI_Hs01_00046632 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103600 predicted 499
2 SASI_Rn01_00103601 predicted 893
3 SASI_Rn01_00103602 predicted 1526
4 SASI_Rn02_00201143 predicted 972
5 SASI_Rn01_00103604 predicted 1236
6 SASI_Rn01_00103605 predicted 1148
7 SASI_Rn01_00103606 predicted 956
8 SASI_Rn01_00103607 predicted 620
9 SASI_Rn01_00103608 predicted 1373
10 SASI_Rn01_00103609 predicted 1263
11 SASI_Rn01_00103603 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044704 predicted 1365
2 SASI_Mm01_00044705 predicted 1022
3 SASI_Mm01_00044706 predicted 1685
4 SASI_Mm01_00044707 predicted 742
5 SASI_Mm01_00044708 predicted 744
6 SASI_Mm01_00044709 predicted 1446
7 SASI_Mm01_00044710 predicted 1389
8 SASI_Mm01_00044711 predicted 1697
9 SASI_Mm01_00044712 predicted 797
10 SASI_Mm01_00044713 predicted 1533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032180
VALIDATED
FAM161A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 161, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-317s1c1
Sequence:CCGGCCTATCACCCTGTCTCATTAACTCGAGTTAATGAGACAGGGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1471s1c1
Sequence:CCGGGAAAGGATGAGAGAATACCAACTCGAGTTGGTATTCTCTCATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032180.1-1668s1c1
Sequence:CCGGCTTCAACAATCAAGAGACGAACTCGAGTTCGTCTCTTGATTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-934s1c1
Sequence:CCGGCGATTTAAAGCCAGACCCATTCTCGAGAATGGGTCTGGCTTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1200s1c1
Sequence:CCGGCTCAGAACACAAGTCTCCAAACTCGAGTTTGGAGACTTGTGTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1555s21c1
Sequence:CCGGGAAACACGTTGGCCTTATTTGCTCGAGCAAATAAGGCCAACGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1485s21c1
Sequence:CCGGATCTCCACATGCATCTATTAACTCGAGTTAATAGATGCATGTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-882s21c1
Sequence:CCGGAGATATCGAAATGGTACATAACTCGAGTTATGTACCATTTCGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032180
VALIDATED
FAM161A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 161, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-317s1c1
Sequence:CCGGCCTATCACCCTGTCTCATTAACTCGAGTTAATGAGACAGGGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1471s1c1
Sequence:CCGGGAAAGGATGAGAGAATACCAACTCGAGTTGGTATTCTCTCATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032180.1-1668s1c1
Sequence:CCGGCTTCAACAATCAAGAGACGAACTCGAGTTCGTCTCTTGATTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-934s1c1
Sequence:CCGGCGATTTAAAGCCAGACCCATTCTCGAGAATGGGTCTGGCTTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1200s1c1
Sequence:CCGGCTCAGAACACAAGTCTCCAAACTCGAGTTTGGAGACTTGTGTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1555s21c1
Sequence:CCGGGAAACACGTTGGCCTTATTTGCTCGAGCAAATAAGGCCAACGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1485s21c1
Sequence:CCGGATCTCCACATGCATCTATTAACTCGAGTTAATAGATGCATGTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-882s21c1
Sequence:CCGGAGATATCGAAATGGTACATAACTCGAGTTATGTACCATTTCGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032180
VALIDATED
FAM161A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 161, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-317s1c1
Sequence:CCGGCCTATCACCCTGTCTCATTAACTCGAGTTAATGAGACAGGGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1471s1c1
Sequence:CCGGGAAAGGATGAGAGAATACCAACTCGAGTTGGTATTCTCTCATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032180.1-1668s1c1
Sequence:CCGGCTTCAACAATCAAGAGACGAACTCGAGTTCGTCTCTTGATTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-934s1c1
Sequence:CCGGCGATTTAAAGCCAGACCCATTCTCGAGAATGGGTCTGGCTTTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032180.1-1200s1c1
Sequence:CCGGCTCAGAACACAAGTCTCCAAACTCGAGTTTGGAGACTTGTGTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1555s21c1
Sequence:CCGGGAAACACGTTGGCCTTATTTGCTCGAGCAAATAAGGCCAACGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-1485s21c1
Sequence:CCGGATCTCCACATGCATCTATTAACTCGAGTTAATAGATGCATGTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032180.2-882s21c1
Sequence:CCGGAGATATCGAAATGGTACATAACTCGAGTTATGTACCATTTCGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028672
FAM161A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 161, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1752s1c1
Sequence:CCGGCCAGCTTTCTGTTTCTCAGTACTCGAGTACTGAGAAACAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1755s1c1
Sequence:CCGGGCTTTCTGTTTCTCAGTACTTCTCGAGAAGTACTGAGAAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-938s1c1
Sequence:CCGGCCCTTTATGAGGATCTAGTCACTCGAGTGACTAGATCCTCATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-1393s1c1
Sequence:CCGGCCAATGCTTTGTGAAGAGTGTCTCGAGACACTCTTCACAAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028672
FAM161A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 161, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1752s1c1
Sequence:CCGGCCAGCTTTCTGTTTCTCAGTACTCGAGTACTGAGAAACAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1755s1c1
Sequence:CCGGGCTTTCTGTTTCTCAGTACTTCTCGAGAAGTACTGAGAAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-938s1c1
Sequence:CCGGCCCTTTATGAGGATCTAGTCACTCGAGTGACTAGATCCTCATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-1393s1c1
Sequence:CCGGCCAATGCTTTGTGAAGAGTGTCTCGAGACACTCTTCACAAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028672
FAM161A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 161, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1752s1c1
Sequence:CCGGCCAGCTTTCTGTTTCTCAGTACTCGAGTACTGAGAAACAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028672.1-1755s1c1
Sequence:CCGGGCTTTCTGTTTCTCAGTACTTCTCGAGAAGTACTGAGAAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-938s1c1
Sequence:CCGGCCCTTTATGAGGATCTAGTCACTCGAGTGACTAGATCCTCATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028672.1-1393s1c1
Sequence:CCGGCCAATGCTTTGTGAAGAGTGTCTCGAGACACTCTTCACAAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks