EMAIL THIS PAGE TO A FRIEND

FAM161B

family with sequence similarity 161, member B

65 Gene Product Result for
Synonyms: C14orf44 c14_5547
UniProtKB ID: Q96MY7, B7Z882, J3KNA2
Gene ID:
Mouse(217705) family with sequence similarity 161, member B
Rat(314311) family with sequence similarity 161, member B
sheep(101105415) family with sequence similarity 161, member B
domestic guinea pig(100720888) family with sequence similarity 161, member B
naked mole-rat(101706416) family with sequence similarity 161, member B
chicken(423341) family with sequence similarity 161, member B
cow(507530) family with sequence similarity 161, member B
domestic cat(101093026) family with sequence similarity 161, member B
dog(490777) family with sequence similarity 161, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103692 Anti-C14ORF44 antibody produced in rabbit affinity isolated antibody canine, human, rabbit, bovine, rat, mouse, horse
western blot pricing
HPA019125 Anti-FAM161B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152445 Rosetta Predictions human pricing
XM_234410 Rosetta Predictions rat pricing
XR_007481 Rosetta Predictions rat pricing
NM_172581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366204 predicted 1539
2 SASI_Hs02_00366205 predicted 1567
3 SASI_Hs02_00366206 predicted 1555
4 SASI_Hs01_00157521 predicted 1223
5 SASI_Hs01_00157522 predicted 1950
6 SASI_Hs02_00366207 predicted 1526
7 SASI_Hs01_00157523 predicted 413
8 SASI_Hs02_00366208 predicted 1727
9 SASI_Hs02_00366209 predicted 1637
10 SASI_Hs01_00157524 predicted 296
11 SASI_Hs01_00157525 predicted 1169
12 SASI_Hs01_00157526 predicted 957
13 SASI_Hs01_00157527 predicted 1232
14 SASI_Hs01_00157528 predicted 1292
15 SASI_Hs01_00157529 predicted 351
16 SASI_Hs01_00157530 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167430 predicted 813
2 SASI_Rn01_00167431 predicted 983
3 SASI_Rn01_00167432 predicted 764
4 SASI_Rn01_00167433 predicted 735
5 SASI_Rn01_00167434 predicted 936
6 SASI_Rn01_00167435 predicted 866
7 SASI_Rn01_00167436 predicted 745
8 SASI_Rn01_00167437 predicted 714
9 SASI_Rn01_00167438 predicted 758
10 SASI_Rn01_00167439 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414696 predicted 1177
2 SASI_Rn02_00414697 predicted 1492
3 SASI_Rn01_00156828 predicted 808
4 SASI_Rn02_00414698 predicted 1256
5 SASI_Rn01_00156830 predicted 972
6 SASI_Rn02_00414699 predicted 1490
7 SASI_Rn02_00414700 predicted 1587
8 SASI_Rn02_00414701 predicted 1538
9 SASI_Rn02_00414702 predicted 1231
10 SASI_Rn01_00156833 predicted 766
11 SASI_Rn01_00156826 predicted 857
12 SASI_Rn01_00156827 predicted 1031
13 SASI_Rn01_00156829 predicted 777
14 SASI_Rn01_00156831 predicted 915
15 SASI_Rn01_00156832 predicted 792
16 SASI_Rn01_00156834 predicted 799
17 SASI_Rn01_00156835 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344258 predicted 1709
2 SASI_Mm01_00164372 predicted 1863
3 SASI_Mm01_00164373 predicted 1873
4 SASI_Mm01_00164374 predicted 1881
5 SASI_Mm01_00164375 predicted 1261
6 SASI_Mm01_00164377 predicted 1185
7 SASI_Mm01_00164378 predicted 242
8 SASI_Mm01_00164379 predicted 1537
9 SASI_Mm01_00164380 predicted 1944
10 SASI_Mm02_00344259 predicted 841
11 SASI_Mm01_00164371 predicted 1206
12 SASI_Mm01_00164376 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172581
FAM161B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 161, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172581.2-1249s21c1
Sequence:CCGGCCGGGAGACAACCAGAAATAACTCGAGTTATTTCTGGTTGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.2-1714s1c1
Sequence:CCGGCTATCTCTTTGAACAAGTTACCTCGAGGTAACTTGTTCAAAGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172581.2-1932s21c1
Sequence:CCGGGAAGTTGCTCACGTGAGATAACTCGAGTTATCTCACGTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172581.1-2700s1c1
Sequence:CCGGCCTGCAATCTTAGCAGCTAAACTCGAGTTTAGCTGCTAAGATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1136s1c1
Sequence:CCGGGCTGAGCTTTCTACAGACTGACTCGAGTCAGTCTGTAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172581.1-2068s1c1
Sequence:CCGGCCTCTTTCATAACTGATGTATCTCGAGATACATCAGTTATGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1467s1c1
Sequence:CCGGGCAGTCCGAATGTCACTTGAACTCGAGTTCAAGTGACATTCGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1621s1c1
Sequence:CCGGCGAAGCTTAAAGAGAACCGGACTCGAGTCCGGTTCTCTTTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1625s1c1
Sequence:CCGGGCTTAAAGAGAACCGGAGCAACTCGAGTTGCTCCGGTTCTCTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.1-165s1c1
Sequence:CCGGGAGCCAGAAGATGAGCAGTTTCTCGAGAAACTGCTCATCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172581
FAM161B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 161, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172581.2-1249s21c1
Sequence:CCGGCCGGGAGACAACCAGAAATAACTCGAGTTATTTCTGGTTGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.2-1714s1c1
Sequence:CCGGCTATCTCTTTGAACAAGTTACCTCGAGGTAACTTGTTCAAAGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172581.2-1932s21c1
Sequence:CCGGGAAGTTGCTCACGTGAGATAACTCGAGTTATCTCACGTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172581.1-2700s1c1
Sequence:CCGGCCTGCAATCTTAGCAGCTAAACTCGAGTTTAGCTGCTAAGATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1136s1c1
Sequence:CCGGGCTGAGCTTTCTACAGACTGACTCGAGTCAGTCTGTAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172581.1-2068s1c1
Sequence:CCGGCCTCTTTCATAACTGATGTATCTCGAGATACATCAGTTATGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1467s1c1
Sequence:CCGGGCAGTCCGAATGTCACTTGAACTCGAGTTCAAGTGACATTCGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1621s1c1
Sequence:CCGGCGAAGCTTAAAGAGAACCGGACTCGAGTCCGGTTCTCTTTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1625s1c1
Sequence:CCGGGCTTAAAGAGAACCGGAGCAACTCGAGTTGCTCCGGTTCTCTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.1-165s1c1
Sequence:CCGGGAGCCAGAAGATGAGCAGTTTCTCGAGAAACTGCTCATCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172581
FAM161B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 161, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172581.2-1249s21c1
Sequence:CCGGCCGGGAGACAACCAGAAATAACTCGAGTTATTTCTGGTTGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.2-1714s1c1
Sequence:CCGGCTATCTCTTTGAACAAGTTACCTCGAGGTAACTTGTTCAAAGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172581.2-1932s21c1
Sequence:CCGGGAAGTTGCTCACGTGAGATAACTCGAGTTATCTCACGTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172581.1-2700s1c1
Sequence:CCGGCCTGCAATCTTAGCAGCTAAACTCGAGTTTAGCTGCTAAGATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1136s1c1
Sequence:CCGGGCTGAGCTTTCTACAGACTGACTCGAGTCAGTCTGTAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172581.1-2068s1c1
Sequence:CCGGCCTCTTTCATAACTGATGTATCTCGAGATACATCAGTTATGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1467s1c1
Sequence:CCGGGCAGTCCGAATGTCACTTGAACTCGAGTTCAAGTGACATTCGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1621s1c1
Sequence:CCGGCGAAGCTTAAAGAGAACCGGACTCGAGTCCGGTTCTCTTTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172581.1-1625s1c1
Sequence:CCGGGCTTAAAGAGAACCGGAGCAACTCGAGTTGCTCCGGTTCTCTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172581.1-165s1c1
Sequence:CCGGGAGCCAGAAGATGAGCAGTTTCTCGAGAAACTGCTCATCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152445
VALIDATED
FAM161B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 161, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-2132s21c1
Sequence:CCGGTTGAGTCATGGCTACTGTTAGCTCGAGCTAACAGTAGCCATGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-1100s21c1
Sequence:CCGGCCTATCGCCTCCTCTAGTAACCTCGAGGTTACTAGAGGAGGCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-1716s21c1
Sequence:CCGGAGGAAATGAAGCAGCGAATACCTCGAGGTATTCGCTGCTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-513s21c1
Sequence:CCGGACAACCTTCCCTCCAACATTCCTCGAGGAATGTTGGAGGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-2031s21c1
Sequence:CCGGATCTCGTATCACTTGCTTAATCTCGAGATTAAGCAAGTGATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-289s21c1
Sequence:CCGGTGACTCAACTGGGAGCATTTACTCGAGTAAATGCTCCCAGTTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-594s21c1
Sequence:CCGGGCTCCTGGGCATCATCCATTACTCGAGTAATGGATGATGCCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-1766s1c1
Sequence:CCGGGCCAAGGATCTAGCCAAGAAACTCGAGTTTCTTGGCTAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-2089s1c1
Sequence:CCGGGCAGCTAACTTGGGTTTGAGTCTCGAGACTCAAACCCAAGTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1666s1c1
Sequence:CCGGGAACCGGAACAATGACCGTAACTCGAGTTACGGTCATTGTTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1908s1c1
Sequence:CCGGCCAGGTTCCAAGAAACTACAACTCGAGTTGTAGTTTCTTGGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1570s1c1
Sequence:CCGGGAAGTCTCAAGCAATGTCCAACTCGAGTTGGACATTGCTTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152445
VALIDATED
FAM161B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 161, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-2132s21c1
Sequence:CCGGTTGAGTCATGGCTACTGTTAGCTCGAGCTAACAGTAGCCATGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-1100s21c1
Sequence:CCGGCCTATCGCCTCCTCTAGTAACCTCGAGGTTACTAGAGGAGGCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-1716s21c1
Sequence:CCGGAGGAAATGAAGCAGCGAATACCTCGAGGTATTCGCTGCTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-513s21c1
Sequence:CCGGACAACCTTCCCTCCAACATTCCTCGAGGAATGTTGGAGGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-2031s21c1
Sequence:CCGGATCTCGTATCACTTGCTTAATCTCGAGATTAAGCAAGTGATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-289s21c1
Sequence:CCGGTGACTCAACTGGGAGCATTTACTCGAGTAAATGCTCCCAGTTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-594s21c1
Sequence:CCGGGCTCCTGGGCATCATCCATTACTCGAGTAATGGATGATGCCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-1766s1c1
Sequence:CCGGGCCAAGGATCTAGCCAAGAAACTCGAGTTTCTTGGCTAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-2089s1c1
Sequence:CCGGGCAGCTAACTTGGGTTTGAGTCTCGAGACTCAAACCCAAGTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1666s1c1
Sequence:CCGGGAACCGGAACAATGACCGTAACTCGAGTTACGGTCATTGTTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1908s1c1
Sequence:CCGGCCAGGTTCCAAGAAACTACAACTCGAGTTGTAGTTTCTTGGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1570s1c1
Sequence:CCGGGAAGTCTCAAGCAATGTCCAACTCGAGTTGGACATTGCTTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152445
VALIDATED
FAM161B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 161, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-2132s21c1
Sequence:CCGGTTGAGTCATGGCTACTGTTAGCTCGAGCTAACAGTAGCCATGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-1100s21c1
Sequence:CCGGCCTATCGCCTCCTCTAGTAACCTCGAGGTTACTAGAGGAGGCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-1716s21c1
Sequence:CCGGAGGAAATGAAGCAGCGAATACCTCGAGGTATTCGCTGCTTCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-513s21c1
Sequence:CCGGACAACCTTCCCTCCAACATTCCTCGAGGAATGTTGGAGGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-2031s21c1
Sequence:CCGGATCTCGTATCACTTGCTTAATCTCGAGATTAAGCAAGTGATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152445.1-289s21c1
Sequence:CCGGTGACTCAACTGGGAGCATTTACTCGAGTAAATGCTCCCAGTTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152445.1-594s21c1
Sequence:CCGGGCTCCTGGGCATCATCCATTACTCGAGTAATGGATGATGCCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-1766s1c1
Sequence:CCGGGCCAAGGATCTAGCCAAGAAACTCGAGTTTCTTGGCTAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152445.1-2089s1c1
Sequence:CCGGGCAGCTAACTTGGGTTTGAGTCTCGAGACTCAAACCCAAGTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1666s1c1
Sequence:CCGGGAACCGGAACAATGACCGTAACTCGAGTTACGGTCATTGTTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1908s1c1
Sequence:CCGGCCAGGTTCCAAGAAACTACAACTCGAGTTGTAGTTTCTTGGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152445.1-1570s1c1
Sequence:CCGGGAAGTCTCAAGCAATGTCCAACTCGAGTTGGACATTGCTTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks