EMAIL THIS PAGE TO A FRIEND

FAM162A

family with sequence similarity 162, member A

54 Gene Product Result for
Synonyms: C3orf28 E2IG5 HGTD-P
UniProtKB ID: Q96A26, Q9NRN6, Q9UJX8
Gene ID:
Mouse(70186) family with sequence similarity 162, member A
Rat(360721) family with sequence similarity 162, member A
Zebrafish(336363) family with sequence similarity 162, member A
chicken(418270) family with sequence similarity 162, member A
cow(617104) family with sequence similarity 162, member A
domestic cat(101090888) family with sequence similarity 162, member A
dog(478584) family with sequence similarity 162, member A
naked mole-rat(101696286) family with sequence similarity 162, member A
domestic guinea pig(100727830) family with sequence similarity 162, member A
sheep(101113293) family with sequence similarity 162, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014367 Rosetta Predictions human pricing
NM_001029903 Rosetta Predictions rat pricing
NM_027342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125824 predicted 424
2 SASI_Hs01_00125825 predicted 298
3 SASI_Hs01_00125826 predicted 471
4 SASI_Hs01_00125827 predicted 296
5 SASI_Hs01_00125828 predicted 425
6 SASI_Hs01_00125829 predicted 393
7 SASI_Hs01_00125830 predicted 445
8 SASI_Hs01_00125831 predicted 447
9 SASI_Hs01_00125832 predicted 385
10 SASI_Hs01_00125833 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054471 predicted 313
2 SASI_Rn01_00054472 predicted 296
3 SASI_Rn01_00054473 predicted 247
4 SASI_Rn01_00054474 predicted 300
5 SASI_Rn01_00054475 predicted 305
6 SASI_Rn02_00203472 predicted 270
7 SASI_Rn01_00054476 predicted 290
8 SASI_Rn01_00054477 predicted 299
9 SASI_Rn01_00054478 predicted 245
10 SASI_Rn01_00054479 predicted 307
11 SASI_Rn01_00054480 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105132 predicted 305
2 SASI_Mm02_00331994 predicted 396
3 SASI_Mm01_00105134 predicted 252
4 SASI_Mm01_00105136 predicted 267
5 SASI_Mm02_00331995 predicted 311
6 SASI_Mm01_00105137 predicted 394
7 SASI_Mm01_00105138 predicted 280
8 SASI_Mm01_00105139 predicted 323
9 SASI_Mm01_00105140 predicted 310
10 SASI_Mm02_00331996 predicted 278
11 SASI_Mm01_00105131 predicted 350
12 SASI_Mm01_00105133 predicted 349
13 SASI_Mm01_00105135 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014367
VALIDATED
FAM162A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 162, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-146s1c1
Sequence:CCGGCTAAGGCTTACCAGAAGCTCTCTCGAGAGAGCTTCTGGTAAGCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-241s1c1
Sequence:CCGGGAGTGCCTTTACACAAACCTACTCGAGTAGGTTTGTGTAAAGGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-358s1c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-340s1c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-534s1c1
Sequence:CCGGGATTACCAAAGGTATCCGTGTCTCGAGACACGGATACCTTTGGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-500s1c1
Sequence:CCGGCTGAAAGAAGGAAGCAGCTATCTCGAGATAGCTGCTTCCTTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-455s1c1
Sequence:CCGGGACCGAGACTTTAACCAGCTTCTCGAGAAGCTGGTTAAAGTCTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-430s21c1
Sequence:CCGGGGATGCATCTTCATGGTTATTCTCGAGAATAACCATGAAGATGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-626s21c1
Sequence:CCGGATGTGGTATGAGGATCCATTTCTCGAGAAATGGATCCTCATACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-360s21c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-378s21c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-600s21c1
Sequence:CCGGGTTATAACGTGCCTGTATTAACTCGAGTTAATACAGGCACGTTATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014367
VALIDATED
FAM162A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 162, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-146s1c1
Sequence:CCGGCTAAGGCTTACCAGAAGCTCTCTCGAGAGAGCTTCTGGTAAGCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-241s1c1
Sequence:CCGGGAGTGCCTTTACACAAACCTACTCGAGTAGGTTTGTGTAAAGGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-358s1c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-340s1c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-534s1c1
Sequence:CCGGGATTACCAAAGGTATCCGTGTCTCGAGACACGGATACCTTTGGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-500s1c1
Sequence:CCGGCTGAAAGAAGGAAGCAGCTATCTCGAGATAGCTGCTTCCTTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-455s1c1
Sequence:CCGGGACCGAGACTTTAACCAGCTTCTCGAGAAGCTGGTTAAAGTCTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-430s21c1
Sequence:CCGGGGATGCATCTTCATGGTTATTCTCGAGAATAACCATGAAGATGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-626s21c1
Sequence:CCGGATGTGGTATGAGGATCCATTTCTCGAGAAATGGATCCTCATACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-360s21c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-378s21c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-600s21c1
Sequence:CCGGGTTATAACGTGCCTGTATTAACTCGAGTTAATACAGGCACGTTATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014367
VALIDATED
FAM162A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 162, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-146s1c1
Sequence:CCGGCTAAGGCTTACCAGAAGCTCTCTCGAGAGAGCTTCTGGTAAGCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-241s1c1
Sequence:CCGGGAGTGCCTTTACACAAACCTACTCGAGTAGGTTTGTGTAAAGGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-358s1c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014367.2-340s1c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014367.2-534s1c1
Sequence:CCGGGATTACCAAAGGTATCCGTGTCTCGAGACACGGATACCTTTGGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-500s1c1
Sequence:CCGGCTGAAAGAAGGAAGCAGCTATCTCGAGATAGCTGCTTCCTTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014367.2-455s1c1
Sequence:CCGGGACCGAGACTTTAACCAGCTTCTCGAGAAGCTGGTTAAAGTCTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-430s21c1
Sequence:CCGGGGATGCATCTTCATGGTTATTCTCGAGAATAACCATGAAGATGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-626s21c1
Sequence:CCGGATGTGGTATGAGGATCCATTTCTCGAGAAATGGATCCTCATACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-360s21c1
Sequence:CCGGGATGCTTGATGCTGCAAAGAACTCGAGTTCTTTGCAGCATCAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-378s21c1
Sequence:CCGGGAACAAGATGCGAGTGAAGATCTCGAGATCTTCACTCGCATCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014367.3-600s21c1
Sequence:CCGGGTTATAACGTGCCTGTATTAACTCGAGTTAATACAGGCACGTTATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027342
VALIDATED
FAM162A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 162, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-261s1c1
Sequence:CCGGGATCCCAGAGACAATCTCATTCTCGAGAATGAGATTGTCTCTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-80s1c1
Sequence:CCGGCCTCGTCTCTAAGGTTTACCACTCGAGTGGTAAACCTTAGAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-264s1c1
Sequence:CCGGCCCAGAGACAATCTCATTTGACTCGAGTCAAATGAGATTGTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-348s1c1
Sequence:CCGGCGTGGCAGGATGCATCTATATCTCGAGATATAGATGCATCCTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027342.1-83s1c1
Sequence:CCGGCGTCTCTAAGGTTTACCAGAACTCGAGTTCTGGTAAACCTTAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027342
VALIDATED
FAM162A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 162, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-261s1c1
Sequence:CCGGGATCCCAGAGACAATCTCATTCTCGAGAATGAGATTGTCTCTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-80s1c1
Sequence:CCGGCCTCGTCTCTAAGGTTTACCACTCGAGTGGTAAACCTTAGAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-264s1c1
Sequence:CCGGCCCAGAGACAATCTCATTTGACTCGAGTCAAATGAGATTGTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-348s1c1
Sequence:CCGGCGTGGCAGGATGCATCTATATCTCGAGATATAGATGCATCCTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027342.1-83s1c1
Sequence:CCGGCGTCTCTAAGGTTTACCAGAACTCGAGTTCTGGTAAACCTTAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027342
VALIDATED
FAM162A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 162, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-261s1c1
Sequence:CCGGGATCCCAGAGACAATCTCATTCTCGAGAATGAGATTGTCTCTGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-80s1c1
Sequence:CCGGCCTCGTCTCTAAGGTTTACCACTCGAGTGGTAAACCTTAGAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-264s1c1
Sequence:CCGGCCCAGAGACAATCTCATTTGACTCGAGTCAAATGAGATTGTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027342.1-348s1c1
Sequence:CCGGCGTGGCAGGATGCATCTATATCTCGAGATATAGATGCATCCTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027342.1-83s1c1
Sequence:CCGGCGTCTCTAAGGTTTACCAGAACTCGAGTTCTGGTAAACCTTAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)