EMAIL THIS PAGE TO A FRIEND

FAM162B

family with sequence similarity 162, member B

57 Gene Product Result for
Synonyms: C6orf189 bA86F4.2
UniProtKB ID: Q5T6X4, Q8IXW8
Gene ID:
Mouse(77296) family with sequence similarity 162, member B
sheep(101104244) family with sequence similarity 162, member B
domestic guinea pig(100723696) family with sequence similarity 162, member B
chicken(100857953) family with sequence similarity 162, member B
cow(783627) family with sequence similarity 162, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085480 Rosetta Predictions human pricing
XM_927381 Rosetta Predictions human pricing
XM_125627 Rosetta Predictions mouse pricing
XM_911116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317955 predicted 506
2 SASI_Hs02_00317956 predicted 413
3 SASI_Hs02_00317957 predicted 409
4 SASI_Hs02_00317958 predicted 371
5 SASI_Hs02_00317959 predicted 463
6 SASI_Hs02_00317960 predicted 512
7 SASI_Hs02_00317961 predicted 376
8 SASI_Hs02_00317962 predicted 374
9 SASI_Hs02_00317963 predicted 339
10 SASI_Hs02_00317964 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267729 predicted 499
2 SASI_Hs01_00267730 predicted 409
3 SASI_Hs01_00267731 predicted 399
4 SASI_Hs01_00267732 predicted 359
5 SASI_Hs01_00267733 predicted 445
6 SASI_Hs01_00267734 predicted 501
7 SASI_Hs01_00267735 predicted 367
8 SASI_Hs01_00267736 predicted 358
9 SASI_Hs01_00267737 predicted 330
10 SASI_Hs01_00267738 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208192 predicted 312
2 SASI_Mm01_00208193 predicted 300
3 SASI_Mm01_00208194 predicted 309
4 SASI_Mm01_00208195 predicted 346
5 SASI_Mm02_00424093 predicted 384
6 SASI_Mm02_00424094 predicted 301
7 SASI_Mm01_00208198 predicted 305
8 SASI_Mm01_00208200 predicted 264
9 SASI_Mm01_00208201 predicted 299
10 SASI_Mm02_00424095 predicted 382
11 SASI_Mm01_00208196 predicted 398
12 SASI_Mm01_00208197 predicted 402
13 SASI_Mm01_00208199 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436161 predicted 298
2 SASI_Mm02_00436162 predicted 310
3 SASI_Mm02_00436163 predicted 355
4 SASI_Mm02_00436164 predicted 389
5 SASI_Mm02_00436165 predicted 297
6 SASI_Mm02_00436166 predicted 388
7 SASI_Mm02_00436167 predicted 211
8 SASI_Mm02_00436168 predicted 308
9 SASI_Mm02_00436169 predicted 261
10 SASI_Mm02_00436170 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085480
FAM162B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 162, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-542s21c1
Sequence:CCGGTAGAACGACATGAATCCTTAACTCGAGTTAAGGATTCATGTCGTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085480.1-832s21c1
Sequence:CCGGTGTATACAGTCTGATAGATATCTCGAGATATCTATCAGACTGTATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-484s21c1
Sequence:CCGGATGATTGGACTCACAATTATCCTCGAGGATAATTGTGAGTCCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-608s21c1
Sequence:CCGGCATTGGCTGCACAGGCTAAAGCTCGAGCTTTAGCCTGTGCAGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-436s21c1
Sequence:CCGGATGATAGACACCGCAAGAAACCTCGAGGTTTCTTGCGGTGTCTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085480
FAM162B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 162, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-542s21c1
Sequence:CCGGTAGAACGACATGAATCCTTAACTCGAGTTAAGGATTCATGTCGTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085480.1-832s21c1
Sequence:CCGGTGTATACAGTCTGATAGATATCTCGAGATATCTATCAGACTGTATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-484s21c1
Sequence:CCGGATGATTGGACTCACAATTATCCTCGAGGATAATTGTGAGTCCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-608s21c1
Sequence:CCGGCATTGGCTGCACAGGCTAAAGCTCGAGCTTTAGCCTGTGCAGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-436s21c1
Sequence:CCGGATGATAGACACCGCAAGAAACCTCGAGGTTTCTTGCGGTGTCTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085480
FAM162B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 162, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-542s21c1
Sequence:CCGGTAGAACGACATGAATCCTTAACTCGAGTTAAGGATTCATGTCGTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085480.1-832s21c1
Sequence:CCGGTGTATACAGTCTGATAGATATCTCGAGATATCTATCAGACTGTATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-484s21c1
Sequence:CCGGATGATTGGACTCACAATTATCCTCGAGGATAATTGTGAGTCCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-608s21c1
Sequence:CCGGCATTGGCTGCACAGGCTAAAGCTCGAGCTTTAGCCTGTGCAGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085480.1-436s21c1
Sequence:CCGGATGATAGACACCGCAAGAAACCTCGAGGTTTCTTGCGGTGTCTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029894
FAM162B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 162, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-341s21c1
Sequence:CCGGGAGTGAAAGCTTGTTACATAACTCGAGTTATGTAACAAGCTTTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-299s21c1
Sequence:CCGGTTGTACCGCCTGAAATGATAGCTCGAGCTATCATTTCAGGCGGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-92s21c1
Sequence:CCGGACCGCGCTCCTCAAATCATCTCTCGAGAGATGATTTGAGGAGCGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-220s21c1
Sequence:CCGGCAGTACAAGCCTTCGAAATTCCTCGAGGAATTTCGAAGGCTTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029894
FAM162B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 162, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-341s21c1
Sequence:CCGGGAGTGAAAGCTTGTTACATAACTCGAGTTATGTAACAAGCTTTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-299s21c1
Sequence:CCGGTTGTACCGCCTGAAATGATAGCTCGAGCTATCATTTCAGGCGGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-92s21c1
Sequence:CCGGACCGCGCTCCTCAAATCATCTCTCGAGAGATGATTTGAGGAGCGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-220s21c1
Sequence:CCGGCAGTACAAGCCTTCGAAATTCCTCGAGGAATTTCGAAGGCTTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029894
FAM162B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 162, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-341s21c1
Sequence:CCGGGAGTGAAAGCTTGTTACATAACTCGAGTTATGTAACAAGCTTTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-299s21c1
Sequence:CCGGTTGTACCGCCTGAAATGATAGCTCGAGCTATCATTTCAGGCGGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-92s21c1
Sequence:CCGGACCGCGCTCCTCAAATCATCTCTCGAGAGATGATTTGAGGAGCGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029894.1-220s21c1
Sequence:CCGGCAGTACAAGCCTTCGAAATTCCTCGAGGAATTTCGAAGGCTTGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)