EMAIL THIS PAGE TO A FRIEND

FAM163A

family with sequence similarity 163, member A

53 Gene Product Result for
Synonyms: C1orf76 NDSP RP11-12M5.2
UniProtKB ID: Q96GL9, A8K8R7
Gene ID:
Mouse(329274) family with sequence similarity 163, member A
Rat(498257) family with sequence similarity 163, member A
chicken(771080) family with sequence similarity 163, member A
cow(613476) family with sequence similarity 163, member A
domestic cat(101081516) family with sequence similarity 163, member A
dog(610860) family with sequence similarity 163, member A
domestic guinea pig(100735397) family with sequence similarity 163, member A
naked mole-rat(101721507) family with sequence similarity 163, member A
sheep(101121873) family with sequence similarity 163, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055551 MISSION® esiRNA esiRNA human FAM163A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173509 Rosetta Predictions human pricing
NM_001109072 Rosetta Predictions rat pricing
NM_177838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210519 predicted 434
2 SASI_Hs01_00210520 predicted 873
3 SASI_Hs01_00210522 predicted 762
4 SASI_Hs01_00210523 predicted 1334
5 SASI_Hs01_00210524 predicted 1209
6 SASI_Hs01_00210525 predicted 863
7 SASI_Hs01_00210526 predicted 1028
8 SASI_Hs01_00210527 predicted 1241
9 SASI_Hs01_00210528 predicted 976
10 SASI_Hs02_00368281 predicted 419
11 SASI_Hs01_00210521 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244850 predicted 1435
2 SASI_Rn02_00244851 predicted 1238
3 SASI_Rn02_00244852 predicted 1337
4 SASI_Rn02_00244853 predicted 1357
5 SASI_Rn02_00244854 predicted 1263
6 SASI_Rn02_00244855 predicted 1361
7 SASI_Rn02_00244856 predicted 910
8 SASI_Rn02_00244857 predicted 437
9 SASI_Rn02_00244858 predicted 1355
10 SASI_Rn02_00244859 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122633 predicted 1321
2 SASI_Mm01_00122634 predicted 1212
3 SASI_Mm01_00122635 predicted 1211
4 SASI_Mm01_00122636 predicted 1064
5 SASI_Mm01_00122637 predicted 1247
6 SASI_Mm01_00122638 predicted 1422
7 SASI_Mm01_00122639 predicted 1076
8 SASI_Mm01_00122640 predicted 925
9 SASI_Mm01_00122642 predicted 1441
10 SASI_Mm02_00348298 predicted 549
11 SASI_Mm01_00122641 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173509
FAM163A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 163, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000139422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173509.2-2246s1c1
Sequence:CCGGCCTGGCGATGAGCCATTTATTCTCGAGAATAAATGGCTCATCGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1923s1c1
Sequence:CCGGCCCATGTACCAGAGAAGGAAACTCGAGTTTCCTTCTCTGGTACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-2464s1c1
Sequence:CCGGGCTGAAATCTTGATTCTGCATCTCGAGATGCAGAATCAAGATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1621s1c1
Sequence:CCGGCGAAATCCTTTCTCTGACTTACTCGAGTAAGTCAGAGAAAGGATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173509
FAM163A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 163, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000139422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173509.2-2246s1c1
Sequence:CCGGCCTGGCGATGAGCCATTTATTCTCGAGAATAAATGGCTCATCGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1923s1c1
Sequence:CCGGCCCATGTACCAGAGAAGGAAACTCGAGTTTCCTTCTCTGGTACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-2464s1c1
Sequence:CCGGGCTGAAATCTTGATTCTGCATCTCGAGATGCAGAATCAAGATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1621s1c1
Sequence:CCGGCGAAATCCTTTCTCTGACTTACTCGAGTAAGTCAGAGAAAGGATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173509
FAM163A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 163, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000139422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173509.2-2246s1c1
Sequence:CCGGCCTGGCGATGAGCCATTTATTCTCGAGAATAAATGGCTCATCGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1923s1c1
Sequence:CCGGCCCATGTACCAGAGAAGGAAACTCGAGTTTCCTTCTCTGGTACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-2464s1c1
Sequence:CCGGGCTGAAATCTTGATTCTGCATCTCGAGATGCAGAATCAAGATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173509.2-1621s1c1
Sequence:CCGGCGAAATCCTTTCTCTGACTTACTCGAGTAAGTCAGAGAAAGGATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177838
FAM163A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 163, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000177494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1454s1c1
Sequence:CCGGGCTAGTTTACACTCTGTTATTCTCGAGAATAACAGAGTGTAAACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1218s1c1
Sequence:CCGGGCGCTATATGACACCTTCCAACTCGAGTTGGAAGGTGTCATATAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177838.2-921s1c1
Sequence:CCGGCTAATCCAAGGGCTATTAGTACTCGAGTACTAATAGCCCTTGGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-2059s1c1
Sequence:CCGGCCATCTATGATGTGACATTATCTCGAGATAATGTCACATCATAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177838
FAM163A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 163, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000177494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1454s1c1
Sequence:CCGGGCTAGTTTACACTCTGTTATTCTCGAGAATAACAGAGTGTAAACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1218s1c1
Sequence:CCGGGCGCTATATGACACCTTCCAACTCGAGTTGGAAGGTGTCATATAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177838.2-921s1c1
Sequence:CCGGCTAATCCAAGGGCTATTAGTACTCGAGTACTAATAGCCCTTGGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-2059s1c1
Sequence:CCGGCCATCTATGATGTGACATTATCTCGAGATAATGTCACATCATAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177838
FAM163A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 163, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000177494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1454s1c1
Sequence:CCGGGCTAGTTTACACTCTGTTATTCTCGAGAATAACAGAGTGTAAACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-1218s1c1
Sequence:CCGGGCGCTATATGACACCTTCCAACTCGAGTTGGAAGGTGTCATATAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177838.2-921s1c1
Sequence:CCGGCTAATCCAAGGGCTATTAGTACTCGAGTACTAATAGCCCTTGGATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177838.2-2059s1c1
Sequence:CCGGCCATCTATGATGTGACATTATCTCGAGATAATGTCACATCATAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)