EMAIL THIS PAGE TO A FRIEND

FAM166A

family with sequence similarity 166, member A

43 Gene Product Result for
UniProtKB ID: Q6J272, A6NND9, Q8N830
Gene ID:
Mouse(68222) family with sequence similarity 166, member A
Rat(311797) family with sequence similarity 166, member A
sheep(101104228) family with sequence similarity 166, member A
domestic guinea pig(100727970) family with sequence similarity 166, member A
naked mole-rat(101713101) family with sequence similarity 166, member A
chicken(771210) family with sequence similarity 166, member A
domestic cat(101081263) family with sequence similarity 166, member A
cow(618445) family with sequence similarity 166, member A
dog(480665) family with sequence similarity 166, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001710 Rosetta Predictions human pricing
NM_001025694 Rosetta Predictions rat pricing
NM_026624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072231 predicted 321
2 SASI_Hs01_00072232 predicted 327
3 SASI_Hs01_00072233 predicted 526
4 SASI_Hs01_00072234 predicted 325
5 SASI_Hs01_00072235 predicted 787
6 SASI_Hs01_00072236 predicted 315
7 SASI_Hs01_00072237 predicted 231
8 SASI_Hs02_00303898 predicted 328
9 SASI_Hs01_00072238 predicted 813
10 SASI_Hs01_00072239 predicted 492
11 SASI_Hs01_00072230 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093479 predicted 1337
2 SASI_Rn01_00093481 predicted 1037
3 SASI_Rn01_00093482 predicted 1041
4 SASI_Rn01_00093483 predicted 641
5 SASI_Rn01_00093484 predicted 1104
6 SASI_Rn01_00093485 predicted 1221
7 SASI_Rn02_00203313 predicted 790
8 SASI_Rn01_00093486 predicted 703
9 SASI_Rn01_00093487 predicted 577
10 SASI_Rn01_00093488 predicted 803
11 SASI_Rn01_00093480 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167520 predicted 629
2 SASI_Mm01_00167521 predicted 892
3 SASI_Mm01_00167523 predicted 500
4 SASI_Mm01_00167524 predicted 757
5 SASI_Mm01_00167525 predicted 857
6 SASI_Mm01_00167526 predicted 570
7 SASI_Mm02_00330593 predicted 238
8 SASI_Mm01_00167527 predicted 843
9 SASI_Mm01_00167528 predicted 218
10 SASI_Mm01_00167529 predicted 772
11 SASI_Mm01_00167522 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026624
FAM166A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 166, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-97s21c1
Sequence:CCGGCCCACTACATCCCTGGTTATGCTCGAGCATAACCAGGGATGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-866s21c1
Sequence:CCGGGCCAAACACCACCATCTATAGCTCGAGCTATAGATGGTGGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-232s21c1
Sequence:CCGGTGACCAAGCCCAAGTTCATTGCTCGAGCAATGAACTTGGGCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-248s1c1
Sequence:CCGGCATTGAGGACTTCAGCAAATCCTCGAGGATTTGCTGAAGTCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-903s1c1
Sequence:CCGGCCTTTCTACATGGGCTTTATCCTCGAGGATAAAGCCCATGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-778s21c1
Sequence:CCGGCACAAGCTATGGATGACTTTGCTCGAGCAAAGTCATCCATAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-507s21c1
Sequence:CCGGCCAGGTCTACTGCTGGCATATCTCGAGATATGCCAGCAGTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.1-778s1c1
Sequence:CCGGCACACAAGCTATGGATGACTTCTCGAGAAGTCATCCATAGCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026624
FAM166A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 166, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-97s21c1
Sequence:CCGGCCCACTACATCCCTGGTTATGCTCGAGCATAACCAGGGATGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-866s21c1
Sequence:CCGGGCCAAACACCACCATCTATAGCTCGAGCTATAGATGGTGGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-232s21c1
Sequence:CCGGTGACCAAGCCCAAGTTCATTGCTCGAGCAATGAACTTGGGCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-248s1c1
Sequence:CCGGCATTGAGGACTTCAGCAAATCCTCGAGGATTTGCTGAAGTCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-903s1c1
Sequence:CCGGCCTTTCTACATGGGCTTTATCCTCGAGGATAAAGCCCATGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-778s21c1
Sequence:CCGGCACAAGCTATGGATGACTTTGCTCGAGCAAAGTCATCCATAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-507s21c1
Sequence:CCGGCCAGGTCTACTGCTGGCATATCTCGAGATATGCCAGCAGTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.1-778s1c1
Sequence:CCGGCACACAAGCTATGGATGACTTCTCGAGAAGTCATCCATAGCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026624
FAM166A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 166, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-97s21c1
Sequence:CCGGCCCACTACATCCCTGGTTATGCTCGAGCATAACCAGGGATGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-866s21c1
Sequence:CCGGGCCAAACACCACCATCTATAGCTCGAGCTATAGATGGTGGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-232s21c1
Sequence:CCGGTGACCAAGCCCAAGTTCATTGCTCGAGCAATGAACTTGGGCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-248s1c1
Sequence:CCGGCATTGAGGACTTCAGCAAATCCTCGAGGATTTGCTGAAGTCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.2-903s1c1
Sequence:CCGGCCTTTCTACATGGGCTTTATCCTCGAGGATAAAGCCCATGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-778s21c1
Sequence:CCGGCACAAGCTATGGATGACTTTGCTCGAGCAAAGTCATCCATAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026624.2-507s21c1
Sequence:CCGGCCAGGTCTACTGCTGGCATATCTCGAGATATGCCAGCAGTAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026624.1-778s1c1
Sequence:CCGGCACACAAGCTATGGATGACTTCTCGAGAAGTCATCCATAGCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001710
FAM166A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 166, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-331s1c1
Sequence:CCGGGAAGCCCTCTAAGAACTTTGACTCGAGTCAAAGTTCTTAGAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-796s1c1
Sequence:CCGGGAGCCAGTTCCTGTTTAGAAACTCGAGTTTCTAAACAGGAACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-987s1c1
Sequence:CCGGCAAAGCGAAACCACACACTATCTCGAGATAGTGTGTGGTTTCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-228s1c1
Sequence:CCGGCCATGTCCAAACCCAAGTTCACTCGAGTGAACTTGGGTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-791s1c1
Sequence:CCGGGACAAGAGCCAGTTCCTGTTTCTCGAGAAACAGGAACTGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-239s1c1
Sequence:CCGGCCCAAGTTCATTGAGGACTTCCTCGAGGAAGTCCTCAATGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-343s1c1
Sequence:CCGGGAACTTTGAGATTCTGGGCCACTCGAGTGGCCCAGAATCTCAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-676s1c1
Sequence:CCGGCCCTAACCTAATCCAACGCAACTCGAGTTGCGTTGGATTAGGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-986s1c1
Sequence:CCGGGCAAAGCGAAACCACACACTACTCGAGTAGTGTGTGGTTTCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001710
FAM166A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 166, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-331s1c1
Sequence:CCGGGAAGCCCTCTAAGAACTTTGACTCGAGTCAAAGTTCTTAGAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-796s1c1
Sequence:CCGGGAGCCAGTTCCTGTTTAGAAACTCGAGTTTCTAAACAGGAACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-987s1c1
Sequence:CCGGCAAAGCGAAACCACACACTATCTCGAGATAGTGTGTGGTTTCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-228s1c1
Sequence:CCGGCCATGTCCAAACCCAAGTTCACTCGAGTGAACTTGGGTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-791s1c1
Sequence:CCGGGACAAGAGCCAGTTCCTGTTTCTCGAGAAACAGGAACTGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-239s1c1
Sequence:CCGGCCCAAGTTCATTGAGGACTTCCTCGAGGAAGTCCTCAATGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-343s1c1
Sequence:CCGGGAACTTTGAGATTCTGGGCCACTCGAGTGGCCCAGAATCTCAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-676s1c1
Sequence:CCGGCCCTAACCTAATCCAACGCAACTCGAGTTGCGTTGGATTAGGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-986s1c1
Sequence:CCGGGCAAAGCGAAACCACACACTACTCGAGTAGTGTGTGGTTTCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001710
FAM166A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 166, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-331s1c1
Sequence:CCGGGAAGCCCTCTAAGAACTTTGACTCGAGTCAAAGTTCTTAGAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-796s1c1
Sequence:CCGGGAGCCAGTTCCTGTTTAGAAACTCGAGTTTCTAAACAGGAACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-987s1c1
Sequence:CCGGCAAAGCGAAACCACACACTATCTCGAGATAGTGTGTGGTTTCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-228s1c1
Sequence:CCGGCCATGTCCAAACCCAAGTTCACTCGAGTGAACTTGGGTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-791s1c1
Sequence:CCGGGACAAGAGCCAGTTCCTGTTTCTCGAGAAACAGGAACTGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001710.1-239s1c1
Sequence:CCGGCCCAAGTTCATTGAGGACTTCCTCGAGGAAGTCCTCAATGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-343s1c1
Sequence:CCGGGAACTTTGAGATTCTGGGCCACTCGAGTGGCCCAGAATCTCAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-676s1c1
Sequence:CCGGCCCTAACCTAATCCAACGCAACTCGAGTTGCGTTGGATTAGGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001710.1-986s1c1
Sequence:CCGGGCAAAGCGAAACCACACACTACTCGAGTAGTGTGTGGTTTCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376939
FAM166A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 166, member A
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376939.1-543s1c1
Sequence:CCGGCATGTCCAAACCCAAGTTCATCTCGAGATGAACTTGGGTTTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376939
FAM166A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 166, member A
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376939.1-543s1c1
Sequence:CCGGCATGTCCAAACCCAAGTTCATCTCGAGATGAACTTGGGTTTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376939
FAM166A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 166, member A
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376939.1-543s1c1
Sequence:CCGGCATGTCCAAACCCAAGTTCATCTCGAGATGAACTTGGGTTTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks