EMAIL THIS PAGE TO A FRIEND

FAM166B

family with sequence similarity 166, member B

33 Gene Product Result for
UniProtKB ID: A8MTA8, A1L3B2, B7ZBJ0
Gene ID:
Mouse(329831) family with sequence similarity 166, member B
Rat(100365928) family with sequence similarity 166, member B
Zebrafish(100009651) family with sequence similarity 166, member B
cow(507810) family with sequence similarity 166, member B
domestic cat(101092554) family with sequence similarity 166, member B
dog(481594) family with sequence similarity 166, member B
domestic guinea pig(101787947) family with sequence similarity 166, member B
sheep(101116962) family with sequence similarity 166, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099951 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099951 Rosetta Predictions human pricing
NM_177377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321604 predicted 448
2 SASI_Hs02_00321605 predicted 251
3 SASI_Hs02_00321606 predicted 417
4 SASI_Hs02_00321607 predicted 413
5 SASI_Hs02_00321608 predicted 452
6 SASI_Hs02_00321609 predicted 462
7 SASI_Hs02_00321610 predicted 591
8 SASI_Hs02_00321611 predicted 302
9 SASI_Hs02_00321612 predicted 569
10 SASI_Hs02_00321613 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050173 predicted 584
2 SASI_Mm02_00347550 predicted 951
3 SASI_Mm01_00050174 predicted 1070
4 SASI_Mm02_00347551 predicted 1022
5 SASI_Mm01_00050176 predicted 934
6 SASI_Mm02_00347552 predicted 908
7 SASI_Mm01_00050180 predicted 969
8 SASI_Mm02_00347553 predicted 1059
9 SASI_Mm02_00347554 predicted 814
10 SASI_Mm01_00050182 predicted 970
11 SASI_Mm01_00050175 predicted 312
12 SASI_Mm01_00050177 predicted 538
13 SASI_Mm01_00050178 predicted 392
14 SASI_Mm01_00050179 predicted 535
15 SASI_Mm01_00050181 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099951
FAM166B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 166, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-561s21c1
Sequence:CCGGCAAGCTTCTCCCTACTCCATGCTCGAGCATGGAGTAGGGAGAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-610s21c1
Sequence:CCGGTGTCAGGCACTGCAGGAATTTCTCGAGAAATTCCTGCAGTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-106s21c1
Sequence:CCGGACCCTCAGAACCCTCATTATACTCGAGTATAATGAGGGTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-138s21c1
Sequence:CCGGACTGGACACTGCCCACTACTTCTCGAGAAGTAGTGGGCAGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-453s21c1
Sequence:CCGGGGGAGTGAAGAGCTACCAAAGCTCGAGCTTTGGTAGCTCTTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099951
FAM166B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 166, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-561s21c1
Sequence:CCGGCAAGCTTCTCCCTACTCCATGCTCGAGCATGGAGTAGGGAGAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-610s21c1
Sequence:CCGGTGTCAGGCACTGCAGGAATTTCTCGAGAAATTCCTGCAGTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-106s21c1
Sequence:CCGGACCCTCAGAACCCTCATTATACTCGAGTATAATGAGGGTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-138s21c1
Sequence:CCGGACTGGACACTGCCCACTACTTCTCGAGAAGTAGTGGGCAGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-453s21c1
Sequence:CCGGGGGAGTGAAGAGCTACCAAAGCTCGAGCTTTGGTAGCTCTTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099951
FAM166B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 166, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-561s21c1
Sequence:CCGGCAAGCTTCTCCCTACTCCATGCTCGAGCATGGAGTAGGGAGAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-610s21c1
Sequence:CCGGTGTCAGGCACTGCAGGAATTTCTCGAGAAATTCCTGCAGTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-106s21c1
Sequence:CCGGACCCTCAGAACCCTCATTATACTCGAGTATAATGAGGGTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-138s21c1
Sequence:CCGGACTGGACACTGCCCACTACTTCTCGAGAAGTAGTGGGCAGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099951.1-453s21c1
Sequence:CCGGGGGAGTGAAGAGCTACCAAAGCTCGAGCTTTGGTAGCTCTTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177377
FAM166B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 166, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1081s21c1
Sequence:CCGGACTCTTGGCCACGCAGGATATCTCGAGATATCCTGCGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1116s21c1
Sequence:CCGGCGGTACATTTGGGCATCTTACCTCGAGGTAAGATGCCCAAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-80s21c1
Sequence:CCGGGCGGCGAGAATCCGCATTATACTCGAGTATAATGCGGATTCTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-911s21c1
Sequence:CCGGTGCTTTGGCAACGGGAATTAACTCGAGTTAATTCCCGTTGCCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1052s21c1
Sequence:CCGGTTTCATGCCTCTGGCTATATACTCGAGTATATAGCCAGAGGCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177377
FAM166B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 166, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1081s21c1
Sequence:CCGGACTCTTGGCCACGCAGGATATCTCGAGATATCCTGCGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1116s21c1
Sequence:CCGGCGGTACATTTGGGCATCTTACCTCGAGGTAAGATGCCCAAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-80s21c1
Sequence:CCGGGCGGCGAGAATCCGCATTATACTCGAGTATAATGCGGATTCTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-911s21c1
Sequence:CCGGTGCTTTGGCAACGGGAATTAACTCGAGTTAATTCCCGTTGCCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1052s21c1
Sequence:CCGGTTTCATGCCTCTGGCTATATACTCGAGTATATAGCCAGAGGCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177377
FAM166B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 166, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1081s21c1
Sequence:CCGGACTCTTGGCCACGCAGGATATCTCGAGATATCCTGCGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1116s21c1
Sequence:CCGGCGGTACATTTGGGCATCTTACCTCGAGGTAAGATGCCCAAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-80s21c1
Sequence:CCGGGCGGCGAGAATCCGCATTATACTCGAGTATAATGCGGATTCTCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-911s21c1
Sequence:CCGGTGCTTTGGCAACGGGAATTAACTCGAGTTAATTCCCGTTGCCAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177377.4-1052s21c1
Sequence:CCGGTTTCATGCCTCTGGCTATATACTCGAGTATATAGCCAGAGGCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks