EMAIL THIS PAGE TO A FRIEND

FAM167A

family with sequence similarity 167, member A

58 Gene Product Result for
Synonyms: C8orf13 D8S265
UniProtKB ID: Q96KS9, A8K3T9, Q3SXY1, Q3SXY3, Q8N3M3, Q9NSR0
Gene ID:
Mouse(219148) family with sequence similarity 167, member A
Rat(498533) family with sequence similarity 167, member A
sheep(101118417) family with sequence similarity 167, member A
domestic guinea pig(100716790) family with sequence similarity 167, member A
naked mole-rat(101706622) family with sequence similarity 167, member A
chicken(770947) family with sequence similarity 167, member A
cow(618107) family with sequence similarity 167, member A
domestic cat(101083842) family with sequence similarity 167, member A
dog(607855) family with sequence similarity 167, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053279 Rosetta Predictions human pricing
NM_001109102 Rosetta Predictions rat pricing
NM_177628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206762 predicted 854
2 SASI_Hs02_00361914 predicted 1616
3 SASI_Hs01_00206763 predicted 1254
4 SASI_Hs01_00206764 predicted 968
5 SASI_Hs01_00206765 predicted 1646
6 SASI_Hs01_00206766 predicted 1052
7 SASI_Hs01_00206767 predicted 875
8 SASI_Hs01_00206770 predicted 1377
9 SASI_Hs01_00206771 predicted 1118
10 SASI_Hs02_00361915 predicted 999
11 SASI_Hs01_00206768 predicted 1410
12 SASI_Hs01_00206769 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245150 predicted 807
2 SASI_Rn02_00245151 predicted 1057
3 SASI_Rn02_00245152 predicted 1013
4 SASI_Rn02_00245153 predicted 1088
5 SASI_Rn02_00245154 predicted 1136
6 SASI_Rn02_00245155 predicted 662
7 SASI_Rn02_00245156 predicted 823
8 SASI_Rn02_00245157 predicted 1044
9 SASI_Rn02_00245158 predicted 1061
10 SASI_Rn02_00245159 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144906 predicted 1785
2 SASI_Mm01_00144907 predicted 1311
3 SASI_Mm01_00144908 predicted 1071
4 SASI_Mm01_00144909 predicted 1074
5 SASI_Mm01_00144910 predicted 1514
6 SASI_Mm02_00347868 predicted 1770
7 SASI_Mm01_00144911 predicted 1780
8 SASI_Mm01_00144912 predicted 1613
9 SASI_Mm01_00144913 predicted 1162
10 SASI_Mm01_00144915 predicted 1637
11 SASI_Mm01_00144914 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177628
FAM167A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 167, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177628.4-3481s1c1
Sequence:CCGGCATAACAGTCACCAGTTATTACTCGAGTAATAACTGGTGACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-842s1c1
Sequence:CCGGGAAGGCTTCCAGAGTATCGATCTCGAGATCGATACTCTGGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-943s1c1
Sequence:CCGGCCGAGGAGACATCAACAAGTTCTCGAGAACTTGTTGATGTCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-948s1c1
Sequence:CCGGGAGACATCAACAAGTTGAAGACTCGAGTCTTCAACTTGTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-636s1c1
Sequence:CCGGGAAGACCTTCCTACCTGGAATCTCGAGATTCCAGGTAGGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-1129s1c1
Sequence:CCGGCAACTCCAGAAGGTTCTCTCTCTCGAGAGAGAGAACCTTCTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-850s1c1
Sequence:CCGGCCAGAGTATCGATGAAGCTATCTCGAGATAGCTTCATCGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-955s1c1
Sequence:CCGGCAACAAGTTGAAGATCGAGCACTCGAGTGCTCGATCTTCAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177628
FAM167A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 167, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177628.4-3481s1c1
Sequence:CCGGCATAACAGTCACCAGTTATTACTCGAGTAATAACTGGTGACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-842s1c1
Sequence:CCGGGAAGGCTTCCAGAGTATCGATCTCGAGATCGATACTCTGGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-943s1c1
Sequence:CCGGCCGAGGAGACATCAACAAGTTCTCGAGAACTTGTTGATGTCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-948s1c1
Sequence:CCGGGAGACATCAACAAGTTGAAGACTCGAGTCTTCAACTTGTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-636s1c1
Sequence:CCGGGAAGACCTTCCTACCTGGAATCTCGAGATTCCAGGTAGGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-1129s1c1
Sequence:CCGGCAACTCCAGAAGGTTCTCTCTCTCGAGAGAGAGAACCTTCTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-850s1c1
Sequence:CCGGCCAGAGTATCGATGAAGCTATCTCGAGATAGCTTCATCGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-955s1c1
Sequence:CCGGCAACAAGTTGAAGATCGAGCACTCGAGTGCTCGATCTTCAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177628
FAM167A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 167, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177628.4-3481s1c1
Sequence:CCGGCATAACAGTCACCAGTTATTACTCGAGTAATAACTGGTGACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-842s1c1
Sequence:CCGGGAAGGCTTCCAGAGTATCGATCTCGAGATCGATACTCTGGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-943s1c1
Sequence:CCGGCCGAGGAGACATCAACAAGTTCTCGAGAACTTGTTGATGTCTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177628.3-948s1c1
Sequence:CCGGGAGACATCAACAAGTTGAAGACTCGAGTCTTCAACTTGTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-636s1c1
Sequence:CCGGGAAGACCTTCCTACCTGGAATCTCGAGATTCCAGGTAGGAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-1129s1c1
Sequence:CCGGCAACTCCAGAAGGTTCTCTCTCTCGAGAGAGAGAACCTTCTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-850s1c1
Sequence:CCGGCCAGAGTATCGATGAAGCTATCTCGAGATAGCTTCATCGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177628.3-955s1c1
Sequence:CCGGCAACAAGTTGAAGATCGAGCACTCGAGTGCTCGATCTTCAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053279
FAM167A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 167, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053279.1-1627s1c1
Sequence:CCGGCCTCTAAGTATTGTCTCAAATCTCGAGATTTGAGACAATACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-963s1c1
Sequence:CCGGTGGCGACATCAACAAGCTGAACTCGAGTTCAGCTTGTTGATGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1140s1c1
Sequence:CCGGGAACATCAACTCTCGGAGGTTCTCGAGAACCTCCGAGAGTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1116s1c1
Sequence:CCGGCAAGCTTATTGGCGTGACCAACTCGAGTTGGTCACGCCAATAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-859s1c1
Sequence:CCGGGAAGGCTTTCAGAGCATCGATCTCGAGATCGATGCTCTGAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053279
FAM167A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 167, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053279.1-1627s1c1
Sequence:CCGGCCTCTAAGTATTGTCTCAAATCTCGAGATTTGAGACAATACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-963s1c1
Sequence:CCGGTGGCGACATCAACAAGCTGAACTCGAGTTCAGCTTGTTGATGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1140s1c1
Sequence:CCGGGAACATCAACTCTCGGAGGTTCTCGAGAACCTCCGAGAGTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1116s1c1
Sequence:CCGGCAAGCTTATTGGCGTGACCAACTCGAGTTGGTCACGCCAATAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-859s1c1
Sequence:CCGGGAAGGCTTTCAGAGCATCGATCTCGAGATCGATGCTCTGAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053279
FAM167A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 167, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053279.1-1627s1c1
Sequence:CCGGCCTCTAAGTATTGTCTCAAATCTCGAGATTTGAGACAATACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-963s1c1
Sequence:CCGGTGGCGACATCAACAAGCTGAACTCGAGTTCAGCTTGTTGATGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1140s1c1
Sequence:CCGGGAACATCAACTCTCGGAGGTTCTCGAGAACCTCCGAGAGTTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-1116s1c1
Sequence:CCGGCAAGCTTATTGGCGTGACCAACTCGAGTTGGTCACGCCAATAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053279.1-859s1c1
Sequence:CCGGGAAGGCTTTCAGAGCATCGATCTCGAGATCGATGCTCTGAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks