EMAIL THIS PAGE TO A FRIEND

FAM167B

family with sequence similarity 167, member B

58 Gene Product Result for
Synonyms: C1orf90
UniProtKB ID: Q9BTA0, Q5TDH6
Gene ID:
Mouse(230766) family with sequence similarity 167, member B
Rat(682360) family with sequence similarity 167, member B
chicken(770783) family with sequence similarity 167, member B
cow(617897) family with sequence similarity 167, member B
domestic cat(101098557) family with sequence similarity 167, member B
dog(611831) family with sequence similarity 167, member B
naked mole-rat(101714745) family with sequence similarity 167, member B
domestic guinea pig(100713566) family with sequence similarity 167, member B
sheep(101115189) family with sequence similarity 167, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032648 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU045871 MISSION® esiRNA esiRNA targeting mouse Fam167b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032648 Rosetta Predictions human pricing
XM_001061186 Rosetta Predictions rat pricing
NM_182783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360200 predicted 409
2 SASI_Hs02_00360201 predicted 406
3 SASI_Hs02_00360202 predicted 325
4 SASI_Hs02_00360203 predicted 311
5 SASI_Hs02_00360204 predicted 527
6 SASI_Hs02_00360205 predicted 323
7 SASI_Hs02_00360206 predicted 409
8 SASI_Hs02_00360207 predicted 219
9 SASI_Hs02_00360208 predicted 407
10 SASI_Hs02_00360209 predicted 409
11 SASI_Hs01_00071813 predicted 505
12 SASI_Hs01_00071814 predicted 633
13 SASI_Hs01_00071815 predicted 639
14 SASI_Hs01_00071816 predicted 526
15 SASI_Hs01_00071817 predicted 659
16 SASI_Hs01_00071818 predicted 506
17 SASI_Hs01_00071819 predicted 635
18 SASI_Hs01_00071820 predicted 667
19 SASI_Hs01_00071821 predicted 510
20 SASI_Hs01_00071822 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299065 predicted 285
2 SASI_Rn02_00299066 predicted 527
3 SASI_Rn02_00299067 predicted 640
4 SASI_Rn02_00299068 predicted 401
5 SASI_Rn02_00299069 predicted 538
6 SASI_Rn02_00299070 predicted 315
7 SASI_Rn02_00299071 predicted 257
8 SASI_Rn02_00299072 predicted 646
9 SASI_Rn02_00299073 predicted 261
10 SASI_Rn02_00299074 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349966 predicted 288
2 SASI_Mm01_00151881 predicted 524
3 SASI_Mm01_00151882 predicted 647
4 SASI_Mm02_00349967 predicted 319
5 SASI_Mm01_00151885 predicted 527
6 SASI_Mm01_00151889 predicted 637
7 SASI_Mm02_00349968 predicted 695
8 SASI_Mm02_00349969 predicted 252
9 SASI_Mm02_00349970 predicted 374
10 SASI_Mm02_00349971 predicted 294
11 SASI_Mm01_00151883 predicted 619
12 SASI_Mm01_00151884 predicted 475
13 SASI_Mm01_00151886 predicted 620
14 SASI_Mm01_00151887 predicted 490
15 SASI_Mm01_00151888 predicted 633
16 SASI_Mm01_00151890 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182783
FAM167B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 167, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-500s1c1
Sequence:CCGGCTGAAAGTGGACCAAGTCTGTCTCGAGACAGACTTGGTCCACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-502s1c1
Sequence:CCGGGAAAGTGGACCAAGTCTGTCACTCGAGTGACAGACTTGGTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-494s1c1
Sequence:CCGGCACAGACTGAAAGTGGACCAACTCGAGTTGGTCCACTTTCAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-425s21c1
Sequence:CCGGTCCATGGATTCTGCGCTTGAGCTCGAGCTCAAGCGCAGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-648s21c1
Sequence:CCGGGACTCACGCGCATGAACATCACTCGAGTGATGTTCATGCGCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182783.2-780s21c1
Sequence:CCGGAGGTGGGCACACTTAGGTTTCCTCGAGGAAACCTAAGTGTGCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-289s21c1
Sequence:CCGGCCTGACTGCCAAGCTTCAACTCTCGAGAGTTGAAGCTTGGCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-257s21c1
Sequence:CCGGGATGAGGAAGAGAGCTTAGATCTCGAGATCTAAGCTCTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182783
FAM167B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 167, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-500s1c1
Sequence:CCGGCTGAAAGTGGACCAAGTCTGTCTCGAGACAGACTTGGTCCACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-502s1c1
Sequence:CCGGGAAAGTGGACCAAGTCTGTCACTCGAGTGACAGACTTGGTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-494s1c1
Sequence:CCGGCACAGACTGAAAGTGGACCAACTCGAGTTGGTCCACTTTCAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-425s21c1
Sequence:CCGGTCCATGGATTCTGCGCTTGAGCTCGAGCTCAAGCGCAGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-648s21c1
Sequence:CCGGGACTCACGCGCATGAACATCACTCGAGTGATGTTCATGCGCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182783.2-780s21c1
Sequence:CCGGAGGTGGGCACACTTAGGTTTCCTCGAGGAAACCTAAGTGTGCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-289s21c1
Sequence:CCGGCCTGACTGCCAAGCTTCAACTCTCGAGAGTTGAAGCTTGGCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-257s21c1
Sequence:CCGGGATGAGGAAGAGAGCTTAGATCTCGAGATCTAAGCTCTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182783
FAM167B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 167, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-500s1c1
Sequence:CCGGCTGAAAGTGGACCAAGTCTGTCTCGAGACAGACTTGGTCCACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-502s1c1
Sequence:CCGGGAAAGTGGACCAAGTCTGTCACTCGAGTGACAGACTTGGTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182783.1-494s1c1
Sequence:CCGGCACAGACTGAAAGTGGACCAACTCGAGTTGGTCCACTTTCAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-425s21c1
Sequence:CCGGTCCATGGATTCTGCGCTTGAGCTCGAGCTCAAGCGCAGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-648s21c1
Sequence:CCGGGACTCACGCGCATGAACATCACTCGAGTGATGTTCATGCGCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182783.2-780s21c1
Sequence:CCGGAGGTGGGCACACTTAGGTTTCCTCGAGGAAACCTAAGTGTGCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-289s21c1
Sequence:CCGGCCTGACTGCCAAGCTTCAACTCTCGAGAGTTGAAGCTTGGCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182783.2-257s21c1
Sequence:CCGGGATGAGGAAGAGAGCTTAGATCTCGAGATCTAAGCTCTCTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032648
FAM167B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 167, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-279s21c1
Sequence:CCGGACTCTGTGAAGGCACTGACAGCTCGAGCTGTCAGTGCCTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-683s21c1
Sequence:CCGGTTCACCCTCTGCTGAGGAACACTCGAGTGTTCCTCAGCAGAGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-326s21c1
Sequence:CCGGCCCTCATATCTGGAGTGGACACTCGAGTGTCCACTCCAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-413s21c1
Sequence:CCGGATCTGTGGTTTCGACTCAATGCTCGAGCATTGAGTCGAAACCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-531s21c1
Sequence:CCGGACCGACTGAAGATGGACCAAGCTCGAGCTTGGTCCATCTTCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032648
FAM167B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 167, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-279s21c1
Sequence:CCGGACTCTGTGAAGGCACTGACAGCTCGAGCTGTCAGTGCCTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-683s21c1
Sequence:CCGGTTCACCCTCTGCTGAGGAACACTCGAGTGTTCCTCAGCAGAGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-326s21c1
Sequence:CCGGCCCTCATATCTGGAGTGGACACTCGAGTGTCCACTCCAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-413s21c1
Sequence:CCGGATCTGTGGTTTCGACTCAATGCTCGAGCATTGAGTCGAAACCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-531s21c1
Sequence:CCGGACCGACTGAAGATGGACCAAGCTCGAGCTTGGTCCATCTTCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032648
FAM167B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 167, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-279s21c1
Sequence:CCGGACTCTGTGAAGGCACTGACAGCTCGAGCTGTCAGTGCCTTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-683s21c1
Sequence:CCGGTTCACCCTCTGCTGAGGAACACTCGAGTGTTCCTCAGCAGAGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-326s21c1
Sequence:CCGGCCCTCATATCTGGAGTGGACACTCGAGTGTCCACTCCAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-413s21c1
Sequence:CCGGATCTGTGGTTTCGACTCAATGCTCGAGCATTGAGTCGAAACCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032648.2-531s21c1
Sequence:CCGGACCGACTGAAGATGGACCAAGCTCGAGCTTGGTCCATCTTCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks