EMAIL THIS PAGE TO A FRIEND

FAM168A

family with sequence similarity 168, member A

56 Gene Product Result for
Synonyms: KIAA0280 TCRP1
UniProtKB ID: Q92567, A2ICY2, A2ID81, Q86UG2
Gene ID:
Mouse(319604) family with sequence similarity 168, member A
Rat(361614) family with sequence similarity 168, member A
sheep(101102261) family with sequence similarity 168, member A
domestic guinea pig(100729144) family with sequence similarity 168, member A
naked mole-rat(101718413) family with sequence similarity 168, member A
Zebrafish(751761) family with sequence similarity 168, member A
chicken(419066) family with sequence similarity 168, member A
chicken(419065) family with sequence similarity 168, member A
dog(609451) family with sequence similarity 168, member A
cow(538693) family with sequence similarity 168, member A
domestic cat(101098573) family with sequence similarity 168, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015159 Rosetta Predictions human pricing
NM_001108494 Rosetta Predictions rat pricing
NM_178764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347125 predicted 424
2 SASI_Hs02_00347126 predicted 718
3 SASI_Hs02_00347127 predicted 455
4 SASI_Hs02_00347128 predicted 1394
5 SASI_Hs02_00347129 predicted 308
6 SASI_Hs02_00347130 predicted 493
7 SASI_Hs02_00347131 predicted 730
8 SASI_Hs02_00347132 predicted 772
9 SASI_Hs02_00347133 predicted 529
10 SASI_Hs02_00347134 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239199 predicted 1370
2 SASI_Rn02_00239200 predicted 1339
3 SASI_Rn02_00239201 predicted 395
4 SASI_Rn02_00239202 predicted 1433
5 SASI_Rn02_00239203 predicted 475
6 SASI_Rn02_00239204 predicted 378
7 SASI_Rn02_00239205 predicted 526
8 SASI_Rn02_00239206 predicted 369
9 SASI_Rn02_00239207 predicted 381
10 SASI_Rn02_00239208 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049372 predicted 1373
2 SASI_Mm01_00049373 predicted 368
3 SASI_Mm01_00049374 predicted 431
4 SASI_Mm01_00049376 predicted 1416
5 SASI_Mm01_00049377 predicted 499
6 SASI_Mm01_00049378 predicted 674
7 SASI_Mm01_00049379 predicted 290
8 SASI_Mm02_00349321 predicted 599
9 SASI_Mm02_00349322 predicted 510
10 SASI_Mm02_00349323 predicted 367
11 SASI_Mm01_00049375 predicted 1400
12 SASI_Mm01_00049380 predicted 387
13 SASI_Mm01_00049381 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015159
VALIDATED
FAM168A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 168, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-1550s21c1
Sequence:CCGGGAGTATGTAGGCGTGTTATTACTCGAGTAATAACACGCCTACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-638s21c1
Sequence:CCGGCCTATCAGACGGCCATGTATCCTCGAGGATACATGGCCGTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-403s21c1
Sequence:CCGGCCCACCAATAGTCCCAGTTATCTCGAGATAACTGGGACTATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-920s21c1
Sequence:CCGGCTGTCTCCATGCCAACATATACTCGAGTATATGTTGGCATGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-543s21c1
Sequence:CCGGCTCTGCGGCTTTCAGATATACCTCGAGGTATATCTGAAAGCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015159
VALIDATED
FAM168A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 168, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-1550s21c1
Sequence:CCGGGAGTATGTAGGCGTGTTATTACTCGAGTAATAACACGCCTACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-638s21c1
Sequence:CCGGCCTATCAGACGGCCATGTATCCTCGAGGATACATGGCCGTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-403s21c1
Sequence:CCGGCCCACCAATAGTCCCAGTTATCTCGAGATAACTGGGACTATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-920s21c1
Sequence:CCGGCTGTCTCCATGCCAACATATACTCGAGTATATGTTGGCATGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-543s21c1
Sequence:CCGGCTCTGCGGCTTTCAGATATACCTCGAGGTATATCTGAAAGCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015159
VALIDATED
FAM168A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 168, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-1550s21c1
Sequence:CCGGGAGTATGTAGGCGTGTTATTACTCGAGTAATAACACGCCTACATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-638s21c1
Sequence:CCGGCCTATCAGACGGCCATGTATCCTCGAGGATACATGGCCGTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-403s21c1
Sequence:CCGGCCCACCAATAGTCCCAGTTATCTCGAGATAACTGGGACTATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015159.1-920s21c1
Sequence:CCGGCTGTCTCCATGCCAACATATACTCGAGTATATGTTGGCATGGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015159.1-543s21c1
Sequence:CCGGCTCTGCGGCTTTCAGATATACCTCGAGGTATATCTGAAAGCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178764
VALIDATED
FAM168A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 168, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178764.3-4785s1c1
Sequence:CCGGGATCCAACAAAGTACGTTAACCTCGAGGTTAACGTACTTTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-465s1c1
Sequence:CCGGCTTTCAGATATACCGCAGGGACTCGAGTCCCTGCGGTATATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-456s1c1
Sequence:CCGGCCTCTGCGGCTTTCAGATATACTCGAGTATATCTGAAAGCCGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-247s1c1
Sequence:CCGGGAACATGGCCTACACTGGTTACTCGAGTAACCAGTGTAGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-242s1c1
Sequence:CCGGCCTAAGAACATGGCCTACACTCTCGAGAGTGTAGGCCATGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-568s1c1
Sequence:CCGGGTATCCAATCAGAAGTGCCTACTCGAGTAGGCACTTCTGATTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-348s1c1
Sequence:CCGGCTCTGCTGATGAAACAAGCCTCTCGAGAGGCTTGTTTCATCAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-540s1c1
Sequence:CCGGCATCACCCAATCCCTATCAGACTCGAGTCTGATAGGGATTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178764
VALIDATED
FAM168A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 168, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178764.3-4785s1c1
Sequence:CCGGGATCCAACAAAGTACGTTAACCTCGAGGTTAACGTACTTTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-465s1c1
Sequence:CCGGCTTTCAGATATACCGCAGGGACTCGAGTCCCTGCGGTATATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-456s1c1
Sequence:CCGGCCTCTGCGGCTTTCAGATATACTCGAGTATATCTGAAAGCCGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-247s1c1
Sequence:CCGGGAACATGGCCTACACTGGTTACTCGAGTAACCAGTGTAGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-242s1c1
Sequence:CCGGCCTAAGAACATGGCCTACACTCTCGAGAGTGTAGGCCATGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-568s1c1
Sequence:CCGGGTATCCAATCAGAAGTGCCTACTCGAGTAGGCACTTCTGATTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-348s1c1
Sequence:CCGGCTCTGCTGATGAAACAAGCCTCTCGAGAGGCTTGTTTCATCAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-540s1c1
Sequence:CCGGCATCACCCAATCCCTATCAGACTCGAGTCTGATAGGGATTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178764
VALIDATED
FAM168A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 168, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178764.3-4785s1c1
Sequence:CCGGGATCCAACAAAGTACGTTAACCTCGAGGTTAACGTACTTTGTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-465s1c1
Sequence:CCGGCTTTCAGATATACCGCAGGGACTCGAGTCCCTGCGGTATATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-456s1c1
Sequence:CCGGCCTCTGCGGCTTTCAGATATACTCGAGTATATCTGAAAGCCGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-247s1c1
Sequence:CCGGGAACATGGCCTACACTGGTTACTCGAGTAACCAGTGTAGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178764.2-242s1c1
Sequence:CCGGCCTAAGAACATGGCCTACACTCTCGAGAGTGTAGGCCATGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178764.2-568s1c1
Sequence:CCGGGTATCCAATCAGAAGTGCCTACTCGAGTAGGCACTTCTGATTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-348s1c1
Sequence:CCGGCTCTGCTGATGAAACAAGCCTCTCGAGAGGCTTGTTTCATCAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178764.2-540s1c1
Sequence:CCGGCATCACCCAATCCCTATCAGACTCGAGTCTGATAGGGATTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks