EMAIL THIS PAGE TO A FRIEND

FAM168B

family with sequence similarity 168, member B

49 Gene Product Result for
Synonyms: MANI
UniProtKB ID: A1KXE4, Q2TAZ6, Q6NZ40
Gene ID:
Mouse(214469) family with sequence similarity 168, member B
Rat(690188) family with sequence similarity 168, member B
Zebrafish(561051) family with sequence similarity 168, member B
chicken(424759) family with sequence similarity 168, member B
cow(505853) family with sequence similarity 168, member B
naked mole-rat(101711829) family with sequence similarity 168, member B
domestic guinea pig(100721756) family with sequence similarity 168, member B
sheep(101104965) family with sequence similarity 168, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009993 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009993 Rosetta Predictions human pricing
XM_001073605 Rosetta Predictions rat pricing
NM_174997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040390 predicted 328
2 SASI_Hs02_00305767 predicted 923
3 SASI_Hs02_00305768 predicted 1272
4 SASI_Hs02_00305769 predicted 898
5 SASI_Hs02_00305770 predicted 1247
6 SASI_Hs02_00305771 predicted 1248
7 SASI_Hs02_00305772 predicted 1080
8 SASI_Hs01_00040394 predicted 363
9 SASI_Hs01_00040395 predicted 367
10 SASI_Hs02_00305773 predicted 1235
11 SASI_Hs01_00040389 predicted 325
12 SASI_Hs01_00040391 predicted 349
13 SASI_Hs01_00040392 predicted 322
14 SASI_Hs01_00040393 predicted 346
15 SASI_Hs01_00040396 predicted 275
16 SASI_Hs01_00040397 predicted 263
17 SASI_Hs01_00040398 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343306 predicted 1071
2 SASI_Rn02_00343307 predicted 496
3 SASI_Rn02_00343308 predicted 1094
4 SASI_Rn02_00343309 predicted 1091
5 SASI_Rn02_00343310 predicted 710
6 SASI_Rn02_00343311 predicted 540
7 SASI_Rn02_00343312 predicted 399
8 SASI_Rn02_00343313 predicted 693
9 SASI_Rn02_00343314 predicted 981
10 SASI_Rn02_00343315 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188759 predicted 1066
2 SASI_Mm01_00188760 predicted 256
3 SASI_Mm01_00188762 predicted 1016
4 SASI_Mm01_00188763 predicted 986
5 SASI_Mm01_00188764 predicted 898
6 SASI_Mm01_00188765 predicted 1009
7 SASI_Mm01_00188766 predicted 1108
8 SASI_Mm01_00188767 predicted 458
9 SASI_Mm02_00345539 predicted 352
10 SASI_Mm01_00188768 predicted 834
11 SASI_Mm01_00188761 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174997
VALIDATED
FAM168B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 168, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-322s1c1
Sequence:CCGGGCACACCTTACAAAGTGTCCTCTCGAGAGGACACTTTGTAAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-207s1c1
Sequence:CCGGGCCAAAGGAATTGGATATCCACTCGAGTGGATATCCAATTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174997.1-195s1c1
Sequence:CCGGCCCTATGCAAATGCCAAAGGACTCGAGTCCTTTGGCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-453s1c1
Sequence:CCGGCAAGGCACGTACTACACACAACTCGAGTTGTGTGTAGTACGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-4780s1c1
Sequence:CCGGGCCAGTTCAATTAGATGTAAACTCGAGTTTACATCTAATTGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174997
VALIDATED
FAM168B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 168, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-322s1c1
Sequence:CCGGGCACACCTTACAAAGTGTCCTCTCGAGAGGACACTTTGTAAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-207s1c1
Sequence:CCGGGCCAAAGGAATTGGATATCCACTCGAGTGGATATCCAATTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174997.1-195s1c1
Sequence:CCGGCCCTATGCAAATGCCAAAGGACTCGAGTCCTTTGGCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-453s1c1
Sequence:CCGGCAAGGCACGTACTACACACAACTCGAGTTGTGTGTAGTACGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-4780s1c1
Sequence:CCGGGCCAGTTCAATTAGATGTAAACTCGAGTTTACATCTAATTGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174997
VALIDATED
FAM168B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 168, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-322s1c1
Sequence:CCGGGCACACCTTACAAAGTGTCCTCTCGAGAGGACACTTTGTAAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-207s1c1
Sequence:CCGGGCCAAAGGAATTGGATATCCACTCGAGTGGATATCCAATTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174997.1-195s1c1
Sequence:CCGGCCCTATGCAAATGCCAAAGGACTCGAGTCCTTTGGCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-453s1c1
Sequence:CCGGCAAGGCACGTACTACACACAACTCGAGTTGTGTGTAGTACGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174997.1-4780s1c1
Sequence:CCGGGCCAGTTCAATTAGATGTAAACTCGAGTTTACATCTAATTGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009993
FAM168B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 168, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-273s1c1
Sequence:CCGGGAATTGGTTATCCAGCTGGTTCTCGAGAACCAGCTGGATAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009993.1-739s1c1
Sequence:CCGGGCCAAGGAATGGAATTTCCATCTCGAGATGGAAATTCCATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-251s1c1
Sequence:CCGGGTTCCCTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-261s1c1
Sequence:CCGGCAAATGCCAAAGGAATTGGTTCTCGAGAACCAATTCCTTTGGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-323s1c1
Sequence:CCGGGCCTATTCTCCTAACATGTATCTCGAGATACATGTTAGGAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009993
FAM168B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 168, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-273s1c1
Sequence:CCGGGAATTGGTTATCCAGCTGGTTCTCGAGAACCAGCTGGATAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009993.1-739s1c1
Sequence:CCGGGCCAAGGAATGGAATTTCCATCTCGAGATGGAAATTCCATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-251s1c1
Sequence:CCGGGTTCCCTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-261s1c1
Sequence:CCGGCAAATGCCAAAGGAATTGGTTCTCGAGAACCAATTCCTTTGGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-323s1c1
Sequence:CCGGGCCTATTCTCCTAACATGTATCTCGAGATACATGTTAGGAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009993
FAM168B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 168, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-273s1c1
Sequence:CCGGGAATTGGTTATCCAGCTGGTTCTCGAGAACCAGCTGGATAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009993.1-739s1c1
Sequence:CCGGGCCAAGGAATGGAATTTCCATCTCGAGATGGAAATTCCATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-251s1c1
Sequence:CCGGGTTCCCTATGCAAATGCCAAACTCGAGTTTGGCATTTGCATAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-261s1c1
Sequence:CCGGCAAATGCCAAAGGAATTGGTTCTCGAGAACCAATTCCTTTGGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009993.1-323s1c1
Sequence:CCGGGCCTATTCTCCTAACATGTATCTCGAGATACATGTTAGGAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks