EMAIL THIS PAGE TO A FRIEND

FAM169A

family with sequence similarity 169, member A

124 Gene Product Result for
Synonyms: SLAP75
UniProtKB ID: Q9Y6X4, A8K1T9, Q6MZT0, Q9H989
Gene ID:
Mouse(320557) family with sequence similarity 169, member A
Rat(310013) family with sequence similarity 169, member A
sheep(101111393) family with sequence similarity 169, member A
domestic guinea pig(100734761) family with sequence similarity 169, member A
naked mole-rat(101707975) family with sequence similarity 169, member A
chicken(431595) family with sequence similarity 169, member A
dog(487248) family with sequence similarity 169, member A
cow(519307) family with sequence similarity 169, member A
domestic cat(101098191) family with sequence similarity 169, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015566 Rosetta Predictions human pricing
XM_001069116 Rosetta Predictions rat pricing
XM_226706 Rosetta Predictions rat pricing
XM_619141 Rosetta Predictions mouse pricing
XM_913243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348126 predicted 1327
2 SASI_Hs02_00348127 predicted 1116
3 SASI_Hs02_00348128 predicted 1697
4 SASI_Hs02_00348129 predicted 1313
5 SASI_Hs02_00348130 predicted 1198
6 SASI_Hs02_00348131 predicted 454
7 SASI_Hs02_00348132 predicted 1115
8 SASI_Hs02_00348133 predicted 1600
9 SASI_Hs02_00348134 predicted 1439
10 SASI_Hs02_00348135 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326968 predicted 996
2 SASI_Rn02_00326969 predicted 1226
3 SASI_Rn02_00326970 predicted 1121
4 SASI_Rn02_00326971 predicted 1732
5 SASI_Rn02_00326972 predicted 835
6 SASI_Rn02_00326973 predicted 894
7 SASI_Rn02_00326974 predicted 271
8 SASI_Rn02_00326975 predicted 665
9 SASI_Rn02_00326976 predicted 1988
10 SASI_Rn02_00326977 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383795 predicted 1000
2 SASI_Rn02_00383796 predicted 1726
3 SASI_Rn02_00383797 predicted 1002
4 SASI_Rn02_00383798 predicted 1285
5 SASI_Rn02_00383799 predicted 1564
6 SASI_Rn02_00383800 predicted 1351
7 SASI_Rn02_00383801 predicted 1263
8 SASI_Rn02_00383802 predicted 1568
9 SASI_Rn02_00383803 predicted 1560
10 SASI_Rn02_00383804 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204261 predicted 1607
2 SASI_Mm01_00204262 predicted 1483
3 SASI_Mm01_00204263 predicted 1972
4 SASI_Mm01_00204264 predicted 1834
5 SASI_Mm01_00204265 predicted 1025
6 SASI_Mm01_00204266 predicted 1502
7 SASI_Mm01_00204267 predicted 972
8 SASI_Mm01_00204268 predicted 1956
9 SASI_Mm01_00204269 predicted 2051
10 SASI_Mm01_00204270 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437595 predicted 1514
2 SASI_Mm02_00437596 predicted 1370
3 SASI_Mm02_00437597 predicted 1384
4 SASI_Mm02_00437598 predicted 571
5 SASI_Mm02_00437599 predicted 518
6 SASI_Mm02_00437600 predicted 1503
7 SASI_Mm02_00437601 predicted 1048
8 SASI_Mm02_00437602 predicted 1604
9 SASI_Mm02_00437603 predicted 1026
10 SASI_Mm02_00437604 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015566
VALIDATED
FAM169A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 169, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-2331s21c1
Sequence:CCGGTGGTACATCTGACCATTATTTCTCGAGAAATAATGGTCAGATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1899s21c1
Sequence:CCGGCCGAGCAACTGGATCAGTTTACTCGAGTAAACTGATCCAGTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-456s21c1
Sequence:CCGGGTCATAGCAGTACTGATTATGCTCGAGCATAATCAGTACTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1024s21c1
Sequence:CCGGTACTCGAAGTGGTAATCTAAACTCGAGTTTAGATTACCACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-391s21c1
Sequence:CCGGGTATGTTCTGAATCGAATTATCTCGAGATAATTCGATTCAGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015566
VALIDATED
FAM169A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 169, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-2331s21c1
Sequence:CCGGTGGTACATCTGACCATTATTTCTCGAGAAATAATGGTCAGATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1899s21c1
Sequence:CCGGCCGAGCAACTGGATCAGTTTACTCGAGTAAACTGATCCAGTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-456s21c1
Sequence:CCGGGTCATAGCAGTACTGATTATGCTCGAGCATAATCAGTACTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1024s21c1
Sequence:CCGGTACTCGAAGTGGTAATCTAAACTCGAGTTTAGATTACCACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-391s21c1
Sequence:CCGGGTATGTTCTGAATCGAATTATCTCGAGATAATTCGATTCAGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015566
VALIDATED
FAM169A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 169, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-2331s21c1
Sequence:CCGGTGGTACATCTGACCATTATTTCTCGAGAAATAATGGTCAGATGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1899s21c1
Sequence:CCGGCCGAGCAACTGGATCAGTTTACTCGAGTAAACTGATCCAGTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-456s21c1
Sequence:CCGGGTCATAGCAGTACTGATTATGCTCGAGCATAATCAGTACTGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015566.1-1024s21c1
Sequence:CCGGTACTCGAAGTGGTAATCTAAACTCGAGTTTAGATTACCACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015566.1-391s21c1
Sequence:CCGGGTATGTTCTGAATCGAATTATCTCGAGATAATTCGATTCAGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks