EMAIL THIS PAGE TO A FRIEND

FAM169B

family with sequence similarity 169, member B

62 Gene Product Result for
UniProtKB ID: Q8N8A8, B5MDL8
Gene ID:
Mouse(434197) family with sequence similarity 169, member B
Rat(680906) family with sequence similarity 169, member B
Zebrafish(558610) family with sequence similarity 169, member B
chicken(415511) family with sequence similarity 169, member B
domestic cat(101100212) family with sequence similarity 169, member B
cow(781793) family with sequence similarity 169, member B
naked mole-rat(101722569) family with sequence similarity 169, member B
domestic guinea pig(100714511) family with sequence similarity 169, member B
sheep(101111912) family with sequence similarity 169, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU176221 MISSION® esiRNA esiRNA targeting mouse Fam169b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182562 Rosetta Predictions human pricing
XM_001059420 Rosetta Predictions rat pricing
NM_001013811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067345 predicted 879
2 SASI_Hs01_00067347 predicted 1015
3 SASI_Hs02_00370690 predicted 1065
4 SASI_Hs01_00067351 predicted 1076
5 SASI_Hs01_00067352 predicted 1120
6 SASI_Hs02_00370691 predicted 619
7 SASI_Hs01_00067348 predicted 1059
8 SASI_Hs01_00067353 predicted 606
9 SASI_Hs01_00067354 predicted 642
10 SASI_Hs02_00370692 predicted 740
11 SASI_Hs01_00067346 predicted 460
12 SASI_Hs01_00067349 predicted 479
13 SASI_Hs01_00067350 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293120 predicted 695
2 SASI_Rn02_00293121 predicted 714
3 SASI_Rn02_00293122 predicted 718
4 SASI_Rn02_00293123 predicted 292
5 SASI_Rn02_00293124 predicted 706
6 SASI_Rn02_00293125 predicted 196
7 SASI_Rn02_00293126 predicted 328
8 SASI_Rn02_00293127 predicted 201
9 SASI_Rn02_00293128 predicted 195
10 SASI_Rn02_00293129 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035735 predicted 570
2 SASI_Mm01_00035736 predicted 814
3 SASI_Mm01_00035737 predicted 689
4 SASI_Mm01_00035738 predicted 1044
5 SASI_Mm01_00035740 predicted 395
6 SASI_Mm01_00035741 predicted 218
7 SASI_Mm01_00035742 predicted 327
8 SASI_Mm01_00035743 predicted 280
9 SASI_Mm01_00035744 predicted 1088
10 SASI_Mm02_00287379 predicted 702
11 SASI_Mm01_00035739 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182562
FAM169B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 169, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1082s21c1
Sequence:CCGGTTCAGAAGCTTACTCGTTAAACTCGAGTTTAACGAGTAAGCTTCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1030s21c1
Sequence:CCGGGCCACAGTGAGGAAGTATTTCCTCGAGGAAATACTTCCTCACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182562.2-287s21c1
Sequence:CCGGTTCATTCTAAACGCCATTATTCTCGAGAATAATGGCGTTTAGAATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-723s1c1
Sequence:CCGGGAGAAGAACTGGAAGACACAACTCGAGTTGTGTCTTCCAGTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-654s1c1
Sequence:CCGGCGAGGACTTCTCAGAATGACACTCGAGTGTCATTCTGAGAAGTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-715s1c1
Sequence:CCGGGATGTGTGGAGAAGAACTGGACTCGAGTCCAGTTCTTCTCCACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-710s1c1
Sequence:CCGGGAGAGGATGTGTGGAGAAGAACTCGAGTTCTTCTCCACACATCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-728s1c1
Sequence:CCGGGAACTGGAAGACACAAAGGATCTCGAGATCCTTTGTGTCTTCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-361s1c1
Sequence:CCGGCTCTGTGAAGGAACAAGCTAACTCGAGTTAGCTTGTTCCTTCACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182562.1-2341s1c1
Sequence:CCGGCCATCTATTCAATCCATTCATCTCGAGATGAATGGATTGAATAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182562
FAM169B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 169, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1082s21c1
Sequence:CCGGTTCAGAAGCTTACTCGTTAAACTCGAGTTTAACGAGTAAGCTTCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1030s21c1
Sequence:CCGGGCCACAGTGAGGAAGTATTTCCTCGAGGAAATACTTCCTCACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182562.2-287s21c1
Sequence:CCGGTTCATTCTAAACGCCATTATTCTCGAGAATAATGGCGTTTAGAATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-723s1c1
Sequence:CCGGGAGAAGAACTGGAAGACACAACTCGAGTTGTGTCTTCCAGTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-654s1c1
Sequence:CCGGCGAGGACTTCTCAGAATGACACTCGAGTGTCATTCTGAGAAGTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-715s1c1
Sequence:CCGGGATGTGTGGAGAAGAACTGGACTCGAGTCCAGTTCTTCTCCACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-710s1c1
Sequence:CCGGGAGAGGATGTGTGGAGAAGAACTCGAGTTCTTCTCCACACATCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-728s1c1
Sequence:CCGGGAACTGGAAGACACAAAGGATCTCGAGATCCTTTGTGTCTTCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-361s1c1
Sequence:CCGGCTCTGTGAAGGAACAAGCTAACTCGAGTTAGCTTGTTCCTTCACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182562.1-2341s1c1
Sequence:CCGGCCATCTATTCAATCCATTCATCTCGAGATGAATGGATTGAATAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182562
FAM169B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 169, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1082s21c1
Sequence:CCGGTTCAGAAGCTTACTCGTTAAACTCGAGTTTAACGAGTAAGCTTCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182562.2-1030s21c1
Sequence:CCGGGCCACAGTGAGGAAGTATTTCCTCGAGGAAATACTTCCTCACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182562.2-287s21c1
Sequence:CCGGTTCATTCTAAACGCCATTATTCTCGAGAATAATGGCGTTTAGAATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-723s1c1
Sequence:CCGGGAGAAGAACTGGAAGACACAACTCGAGTTGTGTCTTCCAGTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-654s1c1
Sequence:CCGGCGAGGACTTCTCAGAATGACACTCGAGTGTCATTCTGAGAAGTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-715s1c1
Sequence:CCGGGATGTGTGGAGAAGAACTGGACTCGAGTCCAGTTCTTCTCCACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182562.1-710s1c1
Sequence:CCGGGAGAGGATGTGTGGAGAAGAACTCGAGTTCTTCTCCACACATCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-728s1c1
Sequence:CCGGGAACTGGAAGACACAAAGGATCTCGAGATCCTTTGTGTCTTCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182562.1-361s1c1
Sequence:CCGGCTCTGTGAAGGAACAAGCTAACTCGAGTTAGCTTGTTCCTTCACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182562.1-2341s1c1
Sequence:CCGGCCATCTATTCAATCCATTCATCTCGAGATGAATGGATTGAATAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013811
FAM169B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 169, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1301s1c1
Sequence:CCGGGCAGGACTTTAGAACGTCATTCTCGAGAATGACGTTCTAAAGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-979s1c1
Sequence:CCGGCACAGTTTAATCATGGAGAAACTCGAGTTTCTCCATGATTAAACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-739s1c1
Sequence:CCGGGTTGTCCGATATCTCCTGCAACTCGAGTTGCAGGAGATATCGGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-851s1c1
Sequence:CCGGGCGTGTTAACATCTGGCTCAACTCGAGTTGAGCCAGATGTTAACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1825s1c1
Sequence:CCGGGCACACATACTTCTCTCATTTCTCGAGAAATGAGAGAAGTATGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-423s1c1
Sequence:CCGGGAAAGGATTGTTCTCTTTGTTCTCGAGAACAAAGAGAACAATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-355s1c1
Sequence:CCGGCCATCGAAGACATCCTAAGAACTCGAGTTCTTAGGATGTCTTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013811
FAM169B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 169, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1301s1c1
Sequence:CCGGGCAGGACTTTAGAACGTCATTCTCGAGAATGACGTTCTAAAGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-979s1c1
Sequence:CCGGCACAGTTTAATCATGGAGAAACTCGAGTTTCTCCATGATTAAACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-739s1c1
Sequence:CCGGGTTGTCCGATATCTCCTGCAACTCGAGTTGCAGGAGATATCGGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-851s1c1
Sequence:CCGGGCGTGTTAACATCTGGCTCAACTCGAGTTGAGCCAGATGTTAACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1825s1c1
Sequence:CCGGGCACACATACTTCTCTCATTTCTCGAGAAATGAGAGAAGTATGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-423s1c1
Sequence:CCGGGAAAGGATTGTTCTCTTTGTTCTCGAGAACAAAGAGAACAATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-355s1c1
Sequence:CCGGCCATCGAAGACATCCTAAGAACTCGAGTTCTTAGGATGTCTTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013811
FAM169B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 169, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1301s1c1
Sequence:CCGGGCAGGACTTTAGAACGTCATTCTCGAGAATGACGTTCTAAAGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-979s1c1
Sequence:CCGGCACAGTTTAATCATGGAGAAACTCGAGTTTCTCCATGATTAAACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-739s1c1
Sequence:CCGGGTTGTCCGATATCTCCTGCAACTCGAGTTGCAGGAGATATCGGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-851s1c1
Sequence:CCGGGCGTGTTAACATCTGGCTCAACTCGAGTTGAGCCAGATGTTAACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013811.1-1825s1c1
Sequence:CCGGGCACACATACTTCTCTCATTTCTCGAGAAATGAGAGAAGTATGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013811.1-423s1c1
Sequence:CCGGGAAAGGATTGTTCTCTTTGTTCTCGAGAACAAAGAGAACAATCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013811.1-355s1c1
Sequence:CCGGCCATCGAAGACATCCTAAGAACTCGAGTTCTTAGGATGTCTTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)