EMAIL THIS PAGE TO A FRIEND

FAM170A

family with sequence similarity 170, member A

55 Gene Product Result for
Synonyms: ZNFD
UniProtKB ID: A1A519, Q66LM8, Q7Z4V2, Q8IW94
Gene ID:
Mouse(225497) family with sequence similarity 170, member A
Rat(498864) family with sequence similarity 170, member A
sheep(101104236) family with sequence similarity 170, member A
domestic guinea pig(100717755) family with sequence similarity 170, member A
naked mole-rat(101707270) family with sequence similarity 170, member A
domestic cat(101081272) family with sequence similarity 170, member A
cow(784593) family with sequence similarity 170, member A
dog(608221) family with sequence similarity 170, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182761 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158211 MISSION® esiRNA esiRNA human FAM170A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182761 Rosetta Predictions human pricing
NM_001126293 Rosetta Predictions rat pricing
NM_001004061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081660 predicted 607
2 SASI_Hs02_00370919 predicted 368
3 SASI_Hs01_00081662 predicted 701
4 SASI_Hs01_00081664 predicted 483
5 SASI_Hs01_00081665 predicted 655
6 SASI_Hs01_00081667 predicted 513
7 SASI_Hs02_00370920 predicted 344
8 SASI_Hs02_00370921 predicted 751
9 SASI_Hs02_00370922 predicted 210
10 SASI_Hs02_00370923 predicted 635
11 SASI_Hs01_00081659 predicted 583
12 SASI_Hs01_00081661 predicted 375
13 SASI_Hs01_00081663 predicted 412
14 SASI_Hs01_00081666 predicted 281
15 SASI_Hs01_00081668 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253303 predicted 397
2 SASI_Rn02_00253304 predicted 417
3 SASI_Rn02_00253305 predicted 377
4 SASI_Rn02_00253306 predicted 479
5 SASI_Rn02_00253307 predicted 383
6 SASI_Rn02_00253308 predicted 248
7 SASI_Rn02_00253309 predicted 285
8 SASI_Rn02_00253310 predicted 204
9 SASI_Rn02_00253311 predicted 476
10 SASI_Rn02_00253312 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286439 predicted 580
2 SASI_Mm01_00137629 predicted 917
3 SASI_Mm01_00137630 predicted 405
4 SASI_Mm01_00137631 predicted 484
5 SASI_Mm01_00137632 predicted 537
6 SASI_Mm01_00137633 predicted 322
7 SASI_Mm01_00137634 predicted 1038
8 SASI_Mm01_00137635 predicted 677
9 SASI_Mm02_00286440 predicted 446
10 SASI_Mm01_00137636 predicted 965
11 SASI_Mm01_00137637 predicted 998
12 SASI_Mm01_00137638 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004061
FAM170A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 170, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1099s1c1
Sequence:CCGGGAAACCGAGAAACCCAAGGAACTCGAGTTCCTTGGGTTTCTCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-1184s1c1
Sequence:CCGGGTCCAGGCTGTGTGTTTGATTCTCGAGAATCAAACACACAGCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-416s1c1
Sequence:CCGGCCTGTGTTTCTTCTCCACAAACTCGAGTTTGTGGAGAAGAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-569s1c1
Sequence:CCGGCGTATAAGACTTGTGTGTCCTCTCGAGAGGACACACAAGTCTTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1190s1c1
Sequence:CCGGGCTGTGTGTTTGATTCTCCAACTCGAGTTGGAGAATCAAACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-970s1c1
Sequence:CCGGCTCCAAGAGCATGTGCAGTATCTCGAGATACTGCACATGCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-916s1c1
Sequence:CCGGGAGAATGGCTTTAGGTGTATGCTCGAGCATACACCTAAAGCCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-297s1c1
Sequence:CCGGGTCAAAGGAAGCTGGAATTTCCTCGAGGAAATTCCAGCTTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-330s1c1
Sequence:CCGGGGATATCTCTCATCCTGAATCCTCGAGGATTCAGGATGAGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004061
FAM170A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 170, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1099s1c1
Sequence:CCGGGAAACCGAGAAACCCAAGGAACTCGAGTTCCTTGGGTTTCTCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-1184s1c1
Sequence:CCGGGTCCAGGCTGTGTGTTTGATTCTCGAGAATCAAACACACAGCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-416s1c1
Sequence:CCGGCCTGTGTTTCTTCTCCACAAACTCGAGTTTGTGGAGAAGAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-569s1c1
Sequence:CCGGCGTATAAGACTTGTGTGTCCTCTCGAGAGGACACACAAGTCTTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1190s1c1
Sequence:CCGGGCTGTGTGTTTGATTCTCCAACTCGAGTTGGAGAATCAAACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-970s1c1
Sequence:CCGGCTCCAAGAGCATGTGCAGTATCTCGAGATACTGCACATGCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-916s1c1
Sequence:CCGGGAGAATGGCTTTAGGTGTATGCTCGAGCATACACCTAAAGCCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-297s1c1
Sequence:CCGGGTCAAAGGAAGCTGGAATTTCCTCGAGGAAATTCCAGCTTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-330s1c1
Sequence:CCGGGGATATCTCTCATCCTGAATCCTCGAGGATTCAGGATGAGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004061
FAM170A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 170, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1099s1c1
Sequence:CCGGGAAACCGAGAAACCCAAGGAACTCGAGTTCCTTGGGTTTCTCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-1184s1c1
Sequence:CCGGGTCCAGGCTGTGTGTTTGATTCTCGAGAATCAAACACACAGCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-416s1c1
Sequence:CCGGCCTGTGTTTCTTCTCCACAAACTCGAGTTTGTGGAGAAGAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-569s1c1
Sequence:CCGGCGTATAAGACTTGTGTGTCCTCTCGAGAGGACACACAAGTCTTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-1190s1c1
Sequence:CCGGGCTGTGTGTTTGATTCTCCAACTCGAGTTGGAGAATCAAACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004061.1-970s1c1
Sequence:CCGGCTCCAAGAGCATGTGCAGTATCTCGAGATACTGCACATGCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-916s1c1
Sequence:CCGGGAGAATGGCTTTAGGTGTATGCTCGAGCATACACCTAAAGCCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-297s1c1
Sequence:CCGGGTCAAAGGAAGCTGGAATTTCCTCGAGGAAATTCCAGCTTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004061.1-330s1c1
Sequence:CCGGGGATATCTCTCATCCTGAATCCTCGAGGATTCAGGATGAGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182761
FAM170A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 170, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-386s1c1
Sequence:CCGGCCTATTCATCCTATAAGACTTCTCGAGAAGTCTTATAGGATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-508s1c1
Sequence:CCGGGAAACTTTGGAGTCCTTAGAACTCGAGTTCTAAGGACTCCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-321s21c1
Sequence:CCGGAGTTACTTCTACCTCCGAATACTCGAGTATTCGGAGGTAGAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182761.2-1245s21c1
Sequence:CCGGACAGGCTGCCCAAGGTATGAACTCGAGTTCATACCTTGGGCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-691s21c1
Sequence:CCGGTCTGATGTGTCCACCAGAAACCTCGAGGTTTCTGGTGGACACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-555s21c1
Sequence:CCGGATACTACATGCAGGTACAAATCTCGAGATTTGTACCTGCATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-484s21c1
Sequence:CCGGTCGTCCTATTCATCCTATAAGCTCGAGCTTATAGGATGAATAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182761
FAM170A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 170, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-386s1c1
Sequence:CCGGCCTATTCATCCTATAAGACTTCTCGAGAAGTCTTATAGGATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-508s1c1
Sequence:CCGGGAAACTTTGGAGTCCTTAGAACTCGAGTTCTAAGGACTCCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-321s21c1
Sequence:CCGGAGTTACTTCTACCTCCGAATACTCGAGTATTCGGAGGTAGAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182761.2-1245s21c1
Sequence:CCGGACAGGCTGCCCAAGGTATGAACTCGAGTTCATACCTTGGGCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-691s21c1
Sequence:CCGGTCTGATGTGTCCACCAGAAACCTCGAGGTTTCTGGTGGACACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-555s21c1
Sequence:CCGGATACTACATGCAGGTACAAATCTCGAGATTTGTACCTGCATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-484s21c1
Sequence:CCGGTCGTCCTATTCATCCTATAAGCTCGAGCTTATAGGATGAATAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182761
FAM170A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 170, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-386s1c1
Sequence:CCGGCCTATTCATCCTATAAGACTTCTCGAGAAGTCTTATAGGATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182761.1-508s1c1
Sequence:CCGGGAAACTTTGGAGTCCTTAGAACTCGAGTTCTAAGGACTCCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-321s21c1
Sequence:CCGGAGTTACTTCTACCTCCGAATACTCGAGTATTCGGAGGTAGAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182761.2-1245s21c1
Sequence:CCGGACAGGCTGCCCAAGGTATGAACTCGAGTTCATACCTTGGGCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-691s21c1
Sequence:CCGGTCTGATGTGTCCACCAGAAACCTCGAGGTTTCTGGTGGACACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-555s21c1
Sequence:CCGGATACTACATGCAGGTACAAATCTCGAGATTTGTACCTGCATGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182761.2-484s21c1
Sequence:CCGGTCGTCCTATTCATCCTATAAGCTCGAGCTTATAGGATGAATAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks