EMAIL THIS PAGE TO A FRIEND

FAM170B

family with sequence similarity 170, member B

88 Gene Product Result for
Synonyms: C10orf73
UniProtKB ID: A6NMN3, Q86WY6, Q8N6K8
Gene ID:
Mouse(105511) family with sequence similarity 170, member B
Rat(100362169) family with sequence similarity 170, member B
dog(100685965) family with sequence similarity 170, member B
cow(615859) family with sequence similarity 170, member B
domestic cat(101095772) family with sequence similarity 170, member B
naked mole-rat(101717110) family with sequence similarity 170, member B
domestic guinea pig(100720326) family with sequence similarity 170, member B
sheep(101116375) family with sequence similarity 170, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001164484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715115 Rosetta Predictions human pricing
XM_096317 Rosetta Predictions human pricing
XM_937528 Rosetta Predictions human pricing
XM_138964 Rosetta Predictions mouse pricing
XM_910194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401557 predicted 889
2 SASI_Hs02_00401558 predicted 1150
3 SASI_Hs02_00401559 predicted 205
4 SASI_Hs02_00401560 predicted 1187
5 SASI_Hs02_00401561 predicted 880
6 SASI_Hs02_00401562 predicted 414
7 SASI_Hs02_00401563 predicted 694
8 SASI_Hs02_00401564 predicted 377
9 SASI_Hs02_00401565 predicted 208
10 SASI_Hs02_00401566 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_096317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478844 predicted 1082
2 SASI_Hs02_00478845 predicted 1176
3 SASI_Hs02_00478846 predicted 1142
4 SASI_Hs01_00267092 predicted 1180
5 SASI_Hs01_00267093 predicted 1188
6 SASI_Hs02_00478847 predicted 1025
7 SASI_Hs02_00478848 predicted 1186
8 SASI_Hs02_00478849 predicted 1081
9 SASI_Hs02_00478850 predicted 1022
10 SASI_Hs02_00478851 predicted 1178
11 SASI_Hs01_00267091 predicted 212
12 SASI_Hs01_00267094 predicted 425
13 SASI_Hs01_00267095 predicted 899
14 SASI_Hs01_00267096 predicted 377
15 SASI_Hs01_00267097 predicted 211
16 SASI_Hs01_00267098 predicted 552
17 SASI_Hs01_00267099 predicted 343
18 SASI_Hs01_00267100 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482636 predicted 887
2 SASI_Hs02_00482637 predicted 1144
3 SASI_Hs02_00482638 predicted 208
4 SASI_Hs02_00482639 predicted 419
5 SASI_Hs02_00482640 predicted 888
6 SASI_Hs02_00482641 predicted 373
7 SASI_Hs02_00482642 predicted 206
8 SASI_Hs02_00482643 predicted 550
9 SASI_Hs02_00482644 predicted 340
10 SASI_Hs02_00482645 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269555 predicted 430
2 SASI_Mm01_00269557 predicted 565
3 SASI_Mm01_00269558 predicted 559
4 SASI_Mm01_00269559 predicted 681
5 SASI_Mm02_00424842 predicted 552
6 SASI_Mm01_00269562 predicted 424
7 SASI_Mm01_00269564 predicted 458
8 SASI_Mm02_00424843 predicted 567
9 SASI_Mm02_00424844 predicted 537
10 SASI_Mm02_00424845 predicted 621
11 SASI_Mm01_00269556 predicted 2236
12 SASI_Mm01_00269560 predicted 1129
13 SASI_Mm01_00269561 predicted 2227
14 SASI_Mm01_00269563 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435404 predicted 430
2 SASI_Mm02_00435405 predicted 221
3 SASI_Mm02_00435406 predicted 573
4 SASI_Mm02_00435407 predicted 554
5 SASI_Mm02_00435408 predicted 683
6 SASI_Mm02_00435409 predicted 350
7 SASI_Mm02_00435410 predicted 265
8 SASI_Mm02_00435411 predicted 458
9 SASI_Mm02_00435412 predicted 337
10 SASI_Mm02_00435413 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164485
FAM170B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 170, member B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164485.1-1512s21c1
Sequence:CCGGGTGGCCACAGGGATTTCTATTCTCGAGAATAGAAATCCCTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-365s21c1
Sequence:CCGGCCTACTCTCAGTACCAGTCCTCTCGAGAGGACTGGTACTGAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-794s21c1
Sequence:CCGGATGGCTTCAGCTGCCAAATATCTCGAGATATTTGGCAGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-229s21c1
Sequence:CCGGATGAGGAGGAATGAGTCATCTCTCGAGAGATGACTCATTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-1235s21c1
Sequence:CCGGAGCAACAGGGAAAGTAGAGATCTCGAGATCTCTACTTTCCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-891s21c1
Sequence:CCGGCCTTTCGGACAGTAGTGAATGCTCGAGCATTCACTACTGTCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164485
FAM170B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 170, member B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164485.1-1512s21c1
Sequence:CCGGGTGGCCACAGGGATTTCTATTCTCGAGAATAGAAATCCCTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-365s21c1
Sequence:CCGGCCTACTCTCAGTACCAGTCCTCTCGAGAGGACTGGTACTGAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-794s21c1
Sequence:CCGGATGGCTTCAGCTGCCAAATATCTCGAGATATTTGGCAGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-229s21c1
Sequence:CCGGATGAGGAGGAATGAGTCATCTCTCGAGAGATGACTCATTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-1235s21c1
Sequence:CCGGAGCAACAGGGAAAGTAGAGATCTCGAGATCTCTACTTTCCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-891s21c1
Sequence:CCGGCCTTTCGGACAGTAGTGAATGCTCGAGCATTCACTACTGTCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164485
FAM170B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 170, member B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164485.1-1512s21c1
Sequence:CCGGGTGGCCACAGGGATTTCTATTCTCGAGAATAGAAATCCCTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-365s21c1
Sequence:CCGGCCTACTCTCAGTACCAGTCCTCTCGAGAGGACTGGTACTGAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-794s21c1
Sequence:CCGGATGGCTTCAGCTGCCAAATATCTCGAGATATTTGGCAGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-229s21c1
Sequence:CCGGATGAGGAGGAATGAGTCATCTCTCGAGAGATGACTCATTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-1235s21c1
Sequence:CCGGAGCAACAGGGAAAGTAGAGATCTCGAGATCTCTACTTTCCCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164485.1-891s21c1
Sequence:CCGGCCTTTCGGACAGTAGTGAATGCTCGAGCATTCACTACTGTCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164484
FAM170B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 170, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-327s21c1
Sequence:CCGGATCCTCAGAGTCCTCCGAGTACTCGAGTACTCGGAGGACTCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1229s21c1
Sequence:CCGGATGGCCAGAGGGATTTCTATTCTCGAGAATAGAAATCCCTCTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-882s21c1
Sequence:CCGGTCCTTCAGACAACAGCGAATGCTCGAGCATTCGCTGTTGTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-204s21c1
Sequence:CCGGGTTCTGGCCAGGGACTATACACTCGAGTGTATAGTCCCTGGCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1142s21c1
Sequence:CCGGATCTCCACCAGAGTCCATTTCCTCGAGGAAATGGACTCTGGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-549s21c1
Sequence:CCGGGAACGGCTCCTCCTTCGAAATCTCGAGATTTCGAAGGAGGAGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-790s21c1
Sequence:CCGGGGCTTCAGCTGTCAGATCTTTCTCGAGAAAGATCTGACAGCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-512s21c1
Sequence:CCGGGCATCCATGAAGCCCAGTTCACTCGAGTGAACTGGGCTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164484
FAM170B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 170, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-327s21c1
Sequence:CCGGATCCTCAGAGTCCTCCGAGTACTCGAGTACTCGGAGGACTCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1229s21c1
Sequence:CCGGATGGCCAGAGGGATTTCTATTCTCGAGAATAGAAATCCCTCTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-882s21c1
Sequence:CCGGTCCTTCAGACAACAGCGAATGCTCGAGCATTCGCTGTTGTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-204s21c1
Sequence:CCGGGTTCTGGCCAGGGACTATACACTCGAGTGTATAGTCCCTGGCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1142s21c1
Sequence:CCGGATCTCCACCAGAGTCCATTTCCTCGAGGAAATGGACTCTGGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-549s21c1
Sequence:CCGGGAACGGCTCCTCCTTCGAAATCTCGAGATTTCGAAGGAGGAGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-790s21c1
Sequence:CCGGGGCTTCAGCTGTCAGATCTTTCTCGAGAAAGATCTGACAGCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-512s21c1
Sequence:CCGGGCATCCATGAAGCCCAGTTCACTCGAGTGAACTGGGCTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164484
FAM170B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 170, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-327s21c1
Sequence:CCGGATCCTCAGAGTCCTCCGAGTACTCGAGTACTCGGAGGACTCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1229s21c1
Sequence:CCGGATGGCCAGAGGGATTTCTATTCTCGAGAATAGAAATCCCTCTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-882s21c1
Sequence:CCGGTCCTTCAGACAACAGCGAATGCTCGAGCATTCGCTGTTGTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-204s21c1
Sequence:CCGGGTTCTGGCCAGGGACTATACACTCGAGTGTATAGTCCCTGGCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164484.1-1142s21c1
Sequence:CCGGATCTCCACCAGAGTCCATTTCCTCGAGGAAATGGACTCTGGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-549s21c1
Sequence:CCGGGAACGGCTCCTCCTTCGAAATCTCGAGATTTCGAAGGAGGAGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-790s21c1
Sequence:CCGGGGCTTCAGCTGTCAGATCTTTCTCGAGAAAGATCTGACAGCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164484.1-512s21c1
Sequence:CCGGGCATCCATGAAGCCCAGTTCACTCGAGTGAACTGGGCTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks