EMAIL THIS PAGE TO A FRIEND

FAM171A1

family with sequence similarity 171, member A1

118 Gene Product Result for
Synonyms: C10orf38
UniProtKB ID: Q5VUB5, D3DRT9, Q32M49, Q8N4I0
Gene ID:
Mouse(269233) family with sequence similarity 171, member A1
Rat(680259) family with sequence similarity 171, member A1
Zebrafish(795681) family with sequence similarity 171, member A1
chicken(420528) family with sequence similarity 171, member A1
cow(534850) family with sequence similarity 171, member A1
domestic cat(101099977) family with sequence similarity 171, member A1
dog(607108) family with sequence similarity 171, member A1
sheep(101117439) family with sequence similarity 171, member A1
domestic guinea pig(100729218) family with sequence similarity 171, member A1
naked mole-rat(101725867) family with sequence similarity 171, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020121 MISSION® esiRNA esiRNA human FAM171A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010924 Rosetta Predictions human pricing
XM_001056358 Rosetta Predictions rat pricing
NM_001081161 Rosetta Predictions mouse pricing
XM_194000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087150 predicted 373
2 SASI_Hs01_00087151 predicted 2157
3 SASI_Hs02_00305916 predicted 208
4 SASI_Hs01_00087152 predicted 891
5 SASI_Hs01_00087154 predicted 2218
6 SASI_Hs02_00305917 predicted 1183
7 SASI_Hs01_00087155 predicted 1820
8 SASI_Hs01_00087156 predicted 1367
9 SASI_Hs01_00087157 predicted 1719
10 SASI_Hs01_00087159 predicted 2293
11 SASI_Hs01_00087153 predicted 2204
12 SASI_Hs01_00087158 predicted 2669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283029 predicted 1209
2 SASI_Rn02_00283030 predicted 1285
3 SASI_Rn02_00283031 predicted 2560
4 SASI_Rn02_00283032 predicted 2043
5 SASI_Rn02_00283033 predicted 1556
6 SASI_Rn02_00283034 predicted 1078
7 SASI_Rn02_00283035 predicted 1369
8 SASI_Rn02_00283036 predicted 1392
9 SASI_Rn02_00283037 predicted 2397
10 SASI_Rn02_00283038 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295781 predicted 2363
2 SASI_Mm02_00295782 predicted 1769
3 SASI_Mm02_00295783 predicted 1534
4 SASI_Mm02_00295784 predicted 2718
5 SASI_Mm02_00295785 predicted 1892
6 SASI_Mm02_00295786 predicted 1715
7 SASI_Mm02_00295787 predicted 1273
8 SASI_Mm02_00295788 predicted 1228
9 SASI_Mm02_00295789 predicted 2656
10 SASI_Mm02_00295790 predicted 2321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282550 predicted 2371
2 SASI_Mm01_00282551 predicted 1061
3 SASI_Mm01_00282552 predicted 2728
4 SASI_Mm01_00282553 predicted 1898
5 SASI_Mm01_00282554 predicted 1719
6 SASI_Mm01_00282555 predicted 1281
7 SASI_Mm01_00282556 predicted 1232
8 SASI_Mm01_00282557 predicted 2913
9 SASI_Mm01_00282558 predicted 2666
10 SASI_Mm01_00282559 predicted 2319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010924
VALIDATED
FAM171A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member A1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-389s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-557s21c1
Sequence:CCGGTTGCGAGGATTAGACGGAAATCTCGAGATTTCCGTCTAATCCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-97s21c1
Sequence:CCGGAGCCCAAGAGGTGACGTTAAACTCGAGTTTAACGTCACCTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2808s21c1
Sequence:CCGGCATTCCTGTTTGCCGTGTAAACTCGAGTTTACACGGCAAACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2224s21c1
Sequence:CCGGTTTGGACTCTGGCGTAGATATCTCGAGATATCTACGCCAGAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168320    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010924.1-3794s1c1
Sequence:CCGGGCGAGCTGAATGTGACTATTACTCGAGTAATAGTCACATTCAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2158s1c1
Sequence:CCGGCGCTCACGTTAGACATTCATACTCGAGTATGAATGTCTAACGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2206s1c1
Sequence:CCGGCGGAAGTAATGATGCCAGTTTCTCGAGAAACTGGCATCATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010924
VALIDATED
FAM171A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member A1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-389s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-557s21c1
Sequence:CCGGTTGCGAGGATTAGACGGAAATCTCGAGATTTCCGTCTAATCCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-97s21c1
Sequence:CCGGAGCCCAAGAGGTGACGTTAAACTCGAGTTTAACGTCACCTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2808s21c1
Sequence:CCGGCATTCCTGTTTGCCGTGTAAACTCGAGTTTACACGGCAAACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2224s21c1
Sequence:CCGGTTTGGACTCTGGCGTAGATATCTCGAGATATCTACGCCAGAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168320    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010924.1-3794s1c1
Sequence:CCGGGCGAGCTGAATGTGACTATTACTCGAGTAATAGTCACATTCAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2158s1c1
Sequence:CCGGCGCTCACGTTAGACATTCATACTCGAGTATGAATGTCTAACGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2206s1c1
Sequence:CCGGCGGAAGTAATGATGCCAGTTTCTCGAGAAACTGGCATCATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010924
VALIDATED
FAM171A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member A1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-389s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-557s21c1
Sequence:CCGGTTGCGAGGATTAGACGGAAATCTCGAGATTTCCGTCTAATCCTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-97s21c1
Sequence:CCGGAGCCCAAGAGGTGACGTTAAACTCGAGTTTAACGTCACCTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2808s21c1
Sequence:CCGGCATTCCTGTTTGCCGTGTAAACTCGAGTTTACACGGCAAACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001010924.1-2224s21c1
Sequence:CCGGTTTGGACTCTGGCGTAGATATCTCGAGATATCTACGCCAGAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168320    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010924.1-3794s1c1
Sequence:CCGGGCGAGCTGAATGTGACTATTACTCGAGTAATAGTCACATTCAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2158s1c1
Sequence:CCGGCGCTCACGTTAGACATTCATACTCGAGTATGAATGTCTAACGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010924.1-2206s1c1
Sequence:CCGGCGGAAGTAATGATGCCAGTTTCTCGAGAAACTGGCATCATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081161
VALIDATED
FAM171A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-550s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1064s21c1
Sequence:CCGGCCACGTATCACACGGTGTTTCCTCGAGGAAACACCGTGTGATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1268s21c1
Sequence:CCGGCTCGACGAGCATCAGATTATCCTCGAGGATAATCTGATGCTCGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2970s21c1
Sequence:CCGGTGACATGGGAATTACGGTTATCTCGAGATAACCGTAATTCCCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2356s21c1
Sequence:CCGGGCTGGAAGGAACGGAAGTAATCTCGAGATTACTTCCGTTCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081161
VALIDATED
FAM171A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-550s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1064s21c1
Sequence:CCGGCCACGTATCACACGGTGTTTCCTCGAGGAAACACCGTGTGATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1268s21c1
Sequence:CCGGCTCGACGAGCATCAGATTATCCTCGAGGATAATCTGATGCTCGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2970s21c1
Sequence:CCGGTGACATGGGAATTACGGTTATCTCGAGATAACCGTAATTCCCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2356s21c1
Sequence:CCGGGCTGGAAGGAACGGAAGTAATCTCGAGATTACTTCCGTTCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081161
VALIDATED
FAM171A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-550s21c1
Sequence:CCGGTATGAAGATGTCGTCCAAATACTCGAGTATTTGGACGACATCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1064s21c1
Sequence:CCGGCCACGTATCACACGGTGTTTCCTCGAGGAAACACCGTGTGATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-1268s21c1
Sequence:CCGGCTCGACGAGCATCAGATTATCCTCGAGGATAATCTGATGCTCGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2970s21c1
Sequence:CCGGTGACATGGGAATTACGGTTATCTCGAGATAACCGTAATTCCCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081161.1-2356s21c1
Sequence:CCGGGCTGGAAGGAACGGAAGTAATCTCGAGATTACTTCCGTTCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks