EMAIL THIS PAGE TO A FRIEND

FAM171A2

family with sequence similarity 171, member A2

59 Gene Product Result for
UniProtKB ID: A8MVW0, A8MQB4
Gene ID:
Mouse(217219) family with sequence similarity 171, member A2
Rat(100361389) family with sequence similarity 171, member A2
naked mole-rat(101715404) family with sequence similarity 171, member A2
domestic guinea pig(100727652) family with sequence similarity 171, member A2
sheep(101116415) family with sequence similarity 171, member A2
dog(612752) family with sequence similarity 171, member A2
cow(615144) family with sequence similarity 171, member A2
domestic cat(101085005) family with sequence similarity 171, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715615 Rosetta Predictions human pricing
XM_001717269 Rosetta Predictions human pricing
XM_208993 Rosetta Predictions human pricing
NM_199200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00404897 predicted 263
2 SASI_Hs02_00404898 predicted 482
3 SASI_Hs02_00404899 predicted 926
4 SASI_Hs02_00404900 predicted 535
5 SASI_Hs02_00404901 predicted 795
6 SASI_Hs02_00404902 predicted 397
7 SASI_Hs02_00404903 predicted 1176
8 SASI_Hs02_00404904 predicted 1222
9 SASI_Hs02_00404905 predicted 1239
10 SASI_Hs02_00404906 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416175 predicted 419
2 SASI_Hs02_00416176 predicted 630
3 SASI_Hs02_00416177 predicted 640
4 SASI_Hs02_00416178 predicted 1087
5 SASI_Hs02_00416179 predicted 693
6 SASI_Hs02_00416180 predicted 947
7 SASI_Hs02_00416181 predicted 554
8 SASI_Hs02_00416182 predicted 1317
9 SASI_Hs02_00416183 predicted 1364
10 SASI_Hs02_00416184 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274036 predicted 418
2 SASI_Hs02_00478946 predicted 626
3 SASI_Hs01_00274037 predicted 645
4 SASI_Hs02_00478947 predicted 1521
5 SASI_Hs01_00274039 predicted 694
6 SASI_Hs01_00274040 predicted 944
7 SASI_Hs01_00274041 predicted 553
8 SASI_Hs02_00478948 predicted 934
9 SASI_Hs01_00274045 predicted 521
10 SASI_Hs02_00478949 predicted 790
11 SASI_Hs01_00274038 predicted 934
12 SASI_Hs01_00274042 predicted 1174
13 SASI_Hs01_00274043 predicted 1223
14 SASI_Hs01_00274044 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351386 predicted 471
2 SASI_Mm01_00156418 predicted 2588
3 SASI_Mm02_00351387 predicted 651
4 SASI_Mm02_00351388 predicted 2584
5 SASI_Mm01_00156422 predicted 1177
6 SASI_Mm01_00156423 predicted 1236
7 SASI_Mm02_00351389 predicted 319
8 SASI_Mm02_00351390 predicted 263
9 SASI_Mm02_00351391 predicted 1047
10 SASI_Mm02_00351392 predicted 2765
11 SASI_Mm01_00156416 predicted 1082
12 SASI_Mm01_00156417 predicted 980
13 SASI_Mm01_00156419 predicted 597
14 SASI_Mm01_00156420 predicted 776
15 SASI_Mm01_00156421 predicted 976
16 SASI_Mm01_00156424 predicted 662
17 SASI_Mm01_00156425 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199200
FAM171A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-866s1c1
Sequence:CCGGGTGCTCATTCTGCTGTGTCTACTCGAGTAGACACAGCAGAATGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-1468s1c1
Sequence:CCGGCAACGTGTACCGCAATGTCATCTCGAGATGACATTGCGGTACACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-671s1c1
Sequence:CCGGCGAAATGGCACTGGTGTGATTCTCGAGAATCACACCAGTGCCATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199200.1-2610s1c1
Sequence:CCGGGATCCTGGAGACTAGAGGATACTCGAGTATCCTCTAGTCTCCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-808s1c1
Sequence:CCGGCATTGGCACCTACCACACAATCTCGAGATTGTGTGGTAGGTGCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199200
FAM171A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-866s1c1
Sequence:CCGGGTGCTCATTCTGCTGTGTCTACTCGAGTAGACACAGCAGAATGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-1468s1c1
Sequence:CCGGCAACGTGTACCGCAATGTCATCTCGAGATGACATTGCGGTACACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-671s1c1
Sequence:CCGGCGAAATGGCACTGGTGTGATTCTCGAGAATCACACCAGTGCCATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199200.1-2610s1c1
Sequence:CCGGGATCCTGGAGACTAGAGGATACTCGAGTATCCTCTAGTCTCCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-808s1c1
Sequence:CCGGCATTGGCACCTACCACACAATCTCGAGATTGTGTGGTAGGTGCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199200
FAM171A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-866s1c1
Sequence:CCGGGTGCTCATTCTGCTGTGTCTACTCGAGTAGACACAGCAGAATGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-1468s1c1
Sequence:CCGGCAACGTGTACCGCAATGTCATCTCGAGATGACATTGCGGTACACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-671s1c1
Sequence:CCGGCGAAATGGCACTGGTGTGATTCTCGAGAATCACACCAGTGCCATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199200.1-2610s1c1
Sequence:CCGGGATCCTGGAGACTAGAGGATACTCGAGTATCCTCTAGTCTCCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199200.1-808s1c1
Sequence:CCGGCATTGGCACCTACCACACAATCTCGAGATTGTGTGGTAGGTGCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198475
FAM171A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-942s21c1
Sequence:CCGGGCGCAATGGCACTGGTGTAATCTCGAGATTACACCAGTGCCATTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-1998s21c1
Sequence:CCGGAGTCACCATCCCTGTGCTATTCTCGAGAATAGCACAGGGATGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-557s21c1
Sequence:CCGGATGAGGACCTGGTGCACATTCCTCGAGGAATGTGCACCAGGTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-898s21c1
Sequence:CCGGAGCATTCCAGCCTGGAGATTTCTCGAGAAATCTCCAGGCTGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-278s21c1
Sequence:CCGGTGATCAAGGTGCAGGTGTATGCTCGAGCATACACCTGCACCTTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198475
FAM171A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-942s21c1
Sequence:CCGGGCGCAATGGCACTGGTGTAATCTCGAGATTACACCAGTGCCATTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-1998s21c1
Sequence:CCGGAGTCACCATCCCTGTGCTATTCTCGAGAATAGCACAGGGATGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-557s21c1
Sequence:CCGGATGAGGACCTGGTGCACATTCCTCGAGGAATGTGCACCAGGTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-898s21c1
Sequence:CCGGAGCATTCCAGCCTGGAGATTTCTCGAGAAATCTCCAGGCTGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-278s21c1
Sequence:CCGGTGATCAAGGTGCAGGTGTATGCTCGAGCATACACCTGCACCTTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198475
FAM171A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-942s21c1
Sequence:CCGGGCGCAATGGCACTGGTGTAATCTCGAGATTACACCAGTGCCATTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-1998s21c1
Sequence:CCGGAGTCACCATCCCTGTGCTATTCTCGAGAATAGCACAGGGATGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-557s21c1
Sequence:CCGGATGAGGACCTGGTGCACATTCCTCGAGGAATGTGCACCAGGTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-898s21c1
Sequence:CCGGAGCATTCCAGCCTGGAGATTTCTCGAGAAATCTCCAGGCTGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198475.2-278s21c1
Sequence:CCGGTGATCAAGGTGCAGGTGTATGCTCGAGCATACACCTGCACCTTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)