EMAIL THIS PAGE TO A FRIEND

FAM172A

family with sequence similarity 172, member A

151 Gene Product Result for
Synonyms: C5orf21
UniProtKB ID: Q8WUF8, B2R7C6, B4DJ14, B4DLG5, Q9H0U8
Gene ID:
Mouse(68675) family with sequence similarity 172, member A
Rat(294606) family with sequence similarity 172, member A
naked mole-rat(101725354) family with sequence similarity 172, member A
sheep(101122278) family with sequence similarity 172, member A
Zebrafish(393390) family with sequence similarity 172, member A
domestic cat(101101442) family with sequence similarity 172, member A
cow(617002) family with sequence similarity 172, member A
chicken(427109) family with sequence similarity 172, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032042 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032042 Rosetta Predictions human pricing
NM_001106401 Rosetta Predictions rat pricing
XM_193728 Rosetta Predictions mouse pricing
XM_911881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192826 predicted 639
2 SASI_Hs01_00192828 predicted 574
3 SASI_Hs01_00192829 predicted 295
4 SASI_Hs02_00359240 predicted 579
5 SASI_Hs01_00192830 predicted 1046
6 SASI_Hs02_00359241 predicted 978
7 SASI_Hs01_00192831 predicted 718
8 SASI_Hs01_00192832 predicted 631
9 SASI_Hs01_00192834 predicted 1236
10 SASI_Hs02_00359242 predicted 913
11 SASI_Hs01_00192825 predicted 768
12 SASI_Hs01_00192827 predicted 989
13 SASI_Hs01_00192833 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218598 predicted 434
2 SASI_Rn02_00218599 predicted 1095
3 SASI_Rn02_00218600 predicted 1026
4 SASI_Rn02_00218601 predicted 763
5 SASI_Rn02_00218602 predicted 222
6 SASI_Rn02_00218603 predicted 811
7 SASI_Rn02_00218604 predicted 903
8 SASI_Rn02_00218605 predicted 868
9 SASI_Rn02_00218606 predicted 394
10 SASI_Rn02_00218607 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_193728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278787 predicted 693
2 SASI_Mm01_00278788 predicted 1204
3 SASI_Mm01_00278789 predicted 771
4 SASI_Mm01_00278790 predicted 923
5 SASI_Mm01_00278791 predicted 825
6 SASI_Mm01_00278792 predicted 391
7 SASI_Mm01_00278793 predicted 878
8 SASI_Mm01_00278794 predicted 1028
9 SASI_Mm01_00278795 predicted 1383
10 SASI_Mm01_00278796 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436694 predicted 696
2 SASI_Mm02_00436695 predicted 1208
3 SASI_Mm02_00436696 predicted 768
4 SASI_Mm02_00436697 predicted 929
5 SASI_Mm02_00436698 predicted 828
6 SASI_Mm02_00436699 predicted 396
7 SASI_Mm02_00436700 predicted 870
8 SASI_Mm02_00436701 predicted 1034
9 SASI_Mm02_00436702 predicted 1385
10 SASI_Mm02_00436703 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032042
VALIDATED
FAM172A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 172, member A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-498s1c1
Sequence:CCGGGCAGTGGGCTAGAAGACTTATCTCGAGATAAGTCTTCTAGCCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-2685s1c1
Sequence:CCGGGCCTTATTTGAGGACATGATACTCGAGTATCATGTCCTCAAATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-1055s1c1
Sequence:CCGGGCTCAGAACCATTAGACACATCTCGAGATGTGTCTAATGGTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032042.3-726s1c1
Sequence:CCGGGCGACGTGATTTCTATGAGAACTCGAGTTCTCATAGAAATCACGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-101s1c1
Sequence:CCGGCTACCGCACTGAAAGATTTATCTCGAGATAAATCTTTCAGTGCGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032042.3-3921s1c1
Sequence:CCGGCGAAACTTAAAGGCCAGATTACTCGAGTAATCTGGCCTTTAAGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-817s1c1
Sequence:CCGGCATGCAATCTATGTTTGGGATCTCGAGATCCCAAACATAGATTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-574s1c1
Sequence:CCGGGCTGAAGGATATGGAGTAATACTCGAGTATTACTCCATATCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-542s1c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-436s1c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-808s1c1
Sequence:CCGGCCTGAAGAACATGCAATCTATCTCGAGATAGATTGCATGTTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-1959s1c1
Sequence:CCGGGCCAGCTAATTGTGAGAGTTTCTCGAGAAACTCTCACAATTAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-634s21c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-740s21c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032042
VALIDATED
FAM172A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 172, member A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-498s1c1
Sequence:CCGGGCAGTGGGCTAGAAGACTTATCTCGAGATAAGTCTTCTAGCCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-2685s1c1
Sequence:CCGGGCCTTATTTGAGGACATGATACTCGAGTATCATGTCCTCAAATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-1055s1c1
Sequence:CCGGGCTCAGAACCATTAGACACATCTCGAGATGTGTCTAATGGTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032042.3-726s1c1
Sequence:CCGGGCGACGTGATTTCTATGAGAACTCGAGTTCTCATAGAAATCACGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-101s1c1
Sequence:CCGGCTACCGCACTGAAAGATTTATCTCGAGATAAATCTTTCAGTGCGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032042.3-3921s1c1
Sequence:CCGGCGAAACTTAAAGGCCAGATTACTCGAGTAATCTGGCCTTTAAGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-817s1c1
Sequence:CCGGCATGCAATCTATGTTTGGGATCTCGAGATCCCAAACATAGATTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-574s1c1
Sequence:CCGGGCTGAAGGATATGGAGTAATACTCGAGTATTACTCCATATCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-542s1c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-436s1c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-808s1c1
Sequence:CCGGCCTGAAGAACATGCAATCTATCTCGAGATAGATTGCATGTTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-1959s1c1
Sequence:CCGGGCCAGCTAATTGTGAGAGTTTCTCGAGAAACTCTCACAATTAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-634s21c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-740s21c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032042
VALIDATED
FAM172A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 172, member A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-498s1c1
Sequence:CCGGGCAGTGGGCTAGAAGACTTATCTCGAGATAAGTCTTCTAGCCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-2685s1c1
Sequence:CCGGGCCTTATTTGAGGACATGATACTCGAGTATCATGTCCTCAAATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032042.3-1055s1c1
Sequence:CCGGGCTCAGAACCATTAGACACATCTCGAGATGTGTCTAATGGTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032042.3-726s1c1
Sequence:CCGGGCGACGTGATTTCTATGAGAACTCGAGTTCTCATAGAAATCACGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-101s1c1
Sequence:CCGGCTACCGCACTGAAAGATTTATCTCGAGATAAATCTTTCAGTGCGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032042.3-3921s1c1
Sequence:CCGGCGAAACTTAAAGGCCAGATTACTCGAGTAATCTGGCCTTTAAGTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-817s1c1
Sequence:CCGGCATGCAATCTATGTTTGGGATCTCGAGATCCCAAACATAGATTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032042.3-574s1c1
Sequence:CCGGGCTGAAGGATATGGAGTAATACTCGAGTATTACTCCATATCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-542s1c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-436s1c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-808s1c1
Sequence:CCGGCCTGAAGAACATGCAATCTATCTCGAGATAGATTGCATGTTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032042.3-1959s1c1
Sequence:CCGGGCCAGCTAATTGTGAGAGTTTCTCGAGAAACTCTCACAATTAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-634s21c1
Sequence:CCGGGCTTTGACAAATCCACAGAAACTCGAGTTTCTGTGGATTTGTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032042.5-740s21c1
Sequence:CCGGGCACACAGATACCGTTTATTACTCGAGTAATAAACGGTATCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138312
FAM172A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 172, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-674s21c1
Sequence:CCGGGTGGGCTAGAAGGCTTATTATCTCGAGATAATAAGCCTTCTAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138312.1-1508s21c1
Sequence:CCGGGTCGTGATGTGTCCGTCTAAACTCGAGTTTAGACGGACACATCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-894s21c1
Sequence:CCGGACAAAGAAGCGTCGTGATTTCCTCGAGGAAATCACGACGCTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-290s21c1
Sequence:CCGGTTTGCTGTCTAGGATCGATTTCTCGAGAAATCGATCCTAGACAGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-486s21c1
Sequence:CCGGGGCGAGATCATCACAAGATATCTCGAGATATCTTGTGATGATCTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138312
FAM172A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 172, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-674s21c1
Sequence:CCGGGTGGGCTAGAAGGCTTATTATCTCGAGATAATAAGCCTTCTAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138312.1-1508s21c1
Sequence:CCGGGTCGTGATGTGTCCGTCTAAACTCGAGTTTAGACGGACACATCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-894s21c1
Sequence:CCGGACAAAGAAGCGTCGTGATTTCCTCGAGGAAATCACGACGCTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-290s21c1
Sequence:CCGGTTTGCTGTCTAGGATCGATTTCTCGAGAAATCGATCCTAGACAGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-486s21c1
Sequence:CCGGGGCGAGATCATCACAAGATATCTCGAGATATCTTGTGATGATCTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138312
FAM172A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 172, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-674s21c1
Sequence:CCGGGTGGGCTAGAAGGCTTATTATCTCGAGATAATAAGCCTTCTAGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138312.1-1508s21c1
Sequence:CCGGGTCGTGATGTGTCCGTCTAAACTCGAGTTTAGACGGACACATCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-894s21c1
Sequence:CCGGACAAAGAAGCGTCGTGATTTCCTCGAGGAAATCACGACGCTTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-290s21c1
Sequence:CCGGTTTGCTGTCTAGGATCGATTTCTCGAGAAATCGATCCTAGACAGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138312.1-486s21c1
Sequence:CCGGGGCGAGATCATCACAAGATATCTCGAGATATCTTGTGATGATCTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)