EMAIL THIS PAGE TO A FRIEND

FAM173A

family with sequence similarity 173, member A

45 Gene Product Result for
Synonyms: C16orf24
UniProtKB ID: Q9BQD7, A2IDD4
Gene ID:
Mouse(214917) family with sequence similarity 173, member A
Rat(287150) family with sequence similarity 173, member A
Zebrafish(100000855) family with sequence similarity 173, member A
chicken(416404) family with sequence similarity 173, member A
dog(490089) family with sequence similarity 173, member A
cow(530342) family with sequence similarity 173, member A
domestic cat(101091835) family with sequence similarity 173, member A
sheep(101111148) family with sequence similarity 173, member A
domestic guinea pig(100721565) family with sequence similarity 173, member A
naked mole-rat(101707610) family with sequence similarity 173, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023933 Rosetta Predictions human pricing
NM_001127447 Rosetta Predictions rat pricing
NM_145410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192254 predicted 533
2 SASI_Hs02_00356399 predicted 411
3 SASI_Hs02_00356400 predicted 303
4 SASI_Hs01_00192256 predicted 496
5 SASI_Hs01_00192257 predicted 619
6 SASI_Hs02_00356401 predicted 412
7 SASI_Hs01_00192258 predicted 488
8 SASI_Hs01_00192260 predicted 362
9 SASI_Hs01_00192261 predicted 409
10 SASI_Hs01_00192262 predicted 474
11 SASI_Hs01_00192255 predicted 505
12 SASI_Hs01_00192259 predicted 377
13 SASI_Hs01_00192263 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253743 predicted 496
2 SASI_Rn02_00253744 predicted 217
3 SASI_Rn02_00253745 predicted 218
4 SASI_Rn02_00253746 predicted 364
5 SASI_Rn02_00253747 predicted 504
6 SASI_Rn02_00253748 predicted 373
7 SASI_Rn02_00253749 predicted 402
8 SASI_Rn02_00253750 predicted 371
9 SASI_Rn02_00253751 predicted 219
10 SASI_Rn02_00253752 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118093 predicted 437
2 SASI_Mm01_00118095 predicted 492
3 SASI_Mm01_00118097 predicted 346
4 SASI_Mm01_00118098 predicted 305
5 SASI_Mm01_00118099 predicted 437
6 SASI_Mm01_00118100 predicted 312
7 SASI_Mm02_00340744 predicted 424
8 SASI_Mm01_00118101 predicted 304
9 SASI_Mm02_00340745 predicted 428
10 SASI_Mm01_00118102 predicted 368
11 SASI_Mm01_00118094 predicted 538
12 SASI_Mm01_00118096 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145410
VALIDATED
FAM173A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 173, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-362s21c1
Sequence:CCGGCTCCGTCCAGCTATGGGATATCTCGAGATATCCCATAGCTGGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-162s21c1
Sequence:CCGGGATTGGCCGTCTATACTATATCTCGAGATATAGTATAGACGGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-644s21c1
Sequence:CCGGGACAGAGTTTGGGCCTATGATCTCGAGATCATAGGCCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-97s21c1
Sequence:CCGGGTTGACTGAGCTACGCGAGAACTCGAGTTCTCGCGTAGCTCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145410
VALIDATED
FAM173A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 173, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-362s21c1
Sequence:CCGGCTCCGTCCAGCTATGGGATATCTCGAGATATCCCATAGCTGGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-162s21c1
Sequence:CCGGGATTGGCCGTCTATACTATATCTCGAGATATAGTATAGACGGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-644s21c1
Sequence:CCGGGACAGAGTTTGGGCCTATGATCTCGAGATCATAGGCCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-97s21c1
Sequence:CCGGGTTGACTGAGCTACGCGAGAACTCGAGTTCTCGCGTAGCTCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145410
VALIDATED
FAM173A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 173, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-362s21c1
Sequence:CCGGCTCCGTCCAGCTATGGGATATCTCGAGATATCCCATAGCTGGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145410.3-162s21c1
Sequence:CCGGGATTGGCCGTCTATACTATATCTCGAGATATAGTATAGACGGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-644s21c1
Sequence:CCGGGACAGAGTTTGGGCCTATGATCTCGAGATCATAGGCCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145410.3-97s21c1
Sequence:CCGGGTTGACTGAGCTACGCGAGAACTCGAGTTCTCGCGTAGCTCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023933
VALIDATED
FAM173A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 173, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-515s21c1
Sequence:CCGGATCTCTGGAAGGTGAGCCTGACTCGAGTCAGGCTCACCTTCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023933.1-697s21c1
Sequence:CCGGGTATGGGCTTATGATGTTCCTCTCGAGAGGAACATCATAAGCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-501s21c1
Sequence:CCGGCTATCGCCGCAAGGATCTCTGCTCGAGCAGAGATCCTTGCGGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-689s21c1
Sequence:CCGGTGGACCGAGTATGGGCTTATGCTCGAGCATAAGCCCATACTCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-706s21c1
Sequence:CCGGTATGATGTTCCTGAGGGTGGGCTCGAGCCCACCCTCAGGAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-704s1c1
Sequence:CCGGCTTATGATGTTCCTGAGGGTGCTCGAGCACCCTCAGGAACATCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-703s1c1
Sequence:CCGGGCTTATGATGTTCCTGAGGGTCTCGAGACCCTCAGGAACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023933
VALIDATED
FAM173A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 173, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-515s21c1
Sequence:CCGGATCTCTGGAAGGTGAGCCTGACTCGAGTCAGGCTCACCTTCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023933.1-697s21c1
Sequence:CCGGGTATGGGCTTATGATGTTCCTCTCGAGAGGAACATCATAAGCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-501s21c1
Sequence:CCGGCTATCGCCGCAAGGATCTCTGCTCGAGCAGAGATCCTTGCGGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-689s21c1
Sequence:CCGGTGGACCGAGTATGGGCTTATGCTCGAGCATAAGCCCATACTCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-706s21c1
Sequence:CCGGTATGATGTTCCTGAGGGTGGGCTCGAGCCCACCCTCAGGAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-704s1c1
Sequence:CCGGCTTATGATGTTCCTGAGGGTGCTCGAGCACCCTCAGGAACATCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-703s1c1
Sequence:CCGGGCTTATGATGTTCCTGAGGGTCTCGAGACCCTCAGGAACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023933
VALIDATED
FAM173A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 173, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-515s21c1
Sequence:CCGGATCTCTGGAAGGTGAGCCTGACTCGAGTCAGGCTCACCTTCCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023933.1-697s21c1
Sequence:CCGGGTATGGGCTTATGATGTTCCTCTCGAGAGGAACATCATAAGCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-501s21c1
Sequence:CCGGCTATCGCCGCAAGGATCTCTGCTCGAGCAGAGATCCTTGCGGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-689s21c1
Sequence:CCGGTGGACCGAGTATGGGCTTATGCTCGAGCATAAGCCCATACTCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_023933.1-706s21c1
Sequence:CCGGTATGATGTTCCTGAGGGTGGGCTCGAGCCCACCCTCAGGAACATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-704s1c1
Sequence:CCGGCTTATGATGTTCCTGAGGGTGCTCGAGCACCCTCAGGAACATCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023933.1-703s1c1
Sequence:CCGGGCTTATGATGTTCCTGAGGGTCTCGAGACCCTCAGGAACATCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks