EMAIL THIS PAGE TO A FRIEND

FAM173B

family with sequence similarity 173, member B

48 Gene Product Result for
Synonyms: JS-2
UniProtKB ID: Q6P4H8, B4DT41, B4DXK2, E9PBZ4
Gene ID:
Mouse(68073) family with sequence similarity 173, member B
Rat(499561) family with sequence similarity 173, member B
naked mole-rat(101722982) family with sequence similarity 173, member B
domestic guinea pig(100716710) family with sequence similarity 173, member B
sheep(101122627) family with sequence similarity 173, member B
Zebrafish(492519) family with sequence similarity 173, member B
chicken(428500) family with sequence similarity 173, member B
domestic cat(101097622) family with sequence similarity 173, member B
cow(525138) family with sequence similarity 173, member B
dog(478620) family with sequence similarity 173, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199133 Rosetta Predictions human pricing
NM_001109178 Rosetta Predictions rat pricing
NM_026546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372565 predicted 718
2 SASI_Hs01_00054425 predicted 564
3 SASI_Hs01_00054426 predicted 385
4 SASI_Hs02_00372566 predicted 560
5 SASI_Hs01_00054427 predicted 794
6 SASI_Hs01_00054428 predicted 778
7 SASI_Hs01_00054429 predicted 404
8 SASI_Hs01_00054430 predicted 516
9 SASI_Hs01_00054431 predicted 768
10 SASI_Hs02_00372567 predicted 328
11 SASI_Hs01_00054422 predicted 791
12 SASI_Hs01_00054423 predicted 689
13 SASI_Hs01_00054424 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245890 predicted 640
2 SASI_Rn02_00245891 predicted 830
3 SASI_Rn02_00245892 predicted 637
4 SASI_Rn02_00245893 predicted 266
5 SASI_Rn02_00245894 predicted 856
6 SASI_Rn02_00245895 predicted 821
7 SASI_Rn02_00245896 predicted 1005
8 SASI_Rn02_00245897 predicted 377
9 SASI_Rn02_00245898 predicted 537
10 SASI_Rn02_00245899 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157657 predicted 743
2 SASI_Mm01_00157658 predicted 800
3 SASI_Mm01_00157659 predicted 455
4 SASI_Mm01_00157660 predicted 445
5 SASI_Mm01_00157661 predicted 244
6 SASI_Mm01_00157662 predicted 806
7 SASI_Mm01_00157663 predicted 308
8 SASI_Mm01_00157664 predicted 814
9 SASI_Mm01_00157665 predicted 802
10 SASI_Mm01_00157666 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026546
VALIDATED
FAM173B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 173, member B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-463s1c1
Sequence:CCGGCAGTACTCCAATGTTGTCATTCTCGAGAATGACAACATTGGAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-195s1c1
Sequence:CCGGCCGGAAAGTTTGTTTGCCATTCTCGAGAATGGCAAACAAACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-906s1c1
Sequence:CCGGGAACTTCTGATCCTTCCACTTCTCGAGAAGTGGAAGGATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-309s1c1
Sequence:CCGGGATTGTGATTGCAGCTGCAAACTCGAGTTTGCAGCTGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-351s1c1
Sequence:CCGGGTATGAATTGAATCCATGGCTCTCGAGAGCCATGGATTCAATTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-370s1c1
Sequence:CCGGCTGGTTTGGTACTCCAGATATCTCGAGATATCTGGAGTACCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026546
VALIDATED
FAM173B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 173, member B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-463s1c1
Sequence:CCGGCAGTACTCCAATGTTGTCATTCTCGAGAATGACAACATTGGAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-195s1c1
Sequence:CCGGCCGGAAAGTTTGTTTGCCATTCTCGAGAATGGCAAACAAACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-906s1c1
Sequence:CCGGGAACTTCTGATCCTTCCACTTCTCGAGAAGTGGAAGGATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-309s1c1
Sequence:CCGGGATTGTGATTGCAGCTGCAAACTCGAGTTTGCAGCTGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-351s1c1
Sequence:CCGGGTATGAATTGAATCCATGGCTCTCGAGAGCCATGGATTCAATTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-370s1c1
Sequence:CCGGCTGGTTTGGTACTCCAGATATCTCGAGATATCTGGAGTACCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026546
VALIDATED
FAM173B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 173, member B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-463s1c1
Sequence:CCGGCAGTACTCCAATGTTGTCATTCTCGAGAATGACAACATTGGAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-195s1c1
Sequence:CCGGCCGGAAAGTTTGTTTGCCATTCTCGAGAATGGCAAACAAACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026546.1-906s1c1
Sequence:CCGGGAACTTCTGATCCTTCCACTTCTCGAGAAGTGGAAGGATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-309s1c1
Sequence:CCGGGATTGTGATTGCAGCTGCAAACTCGAGTTTGCAGCTGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026546.1-351s1c1
Sequence:CCGGGTATGAATTGAATCCATGGCTCTCGAGAGCCATGGATTCAATTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026546.1-370s1c1
Sequence:CCGGCTGGTTTGGTACTCCAGATATCTCGAGATATCTGGAGTACCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199133
VALIDATED
FAM173B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 173, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-208s1c1
Sequence:CCGGGCCATTTGTACCTGCAACTATCTCGAGATAGTTGCAGGTACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-664s1c1
Sequence:CCGGGCCCTGTACATCGATGCATTTCTCGAGAAATGCATCGATGTACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-1028s1c1
Sequence:CCGGGCCTCGATAAGGAGAAATGATCTCGAGATCATTTCTCCTTATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-521s1c1
Sequence:CCGGCTTGAACGTGAACTTGAGGATCTCGAGATCCTCAAGTTCACGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-512s1c1
Sequence:CCGGGAGAAGAAACTTGAACGTGAACTCGAGTTCACGTTCAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-1184s21c1
Sequence:CCGGGGATTCAGAGAGGCGTTTATACTCGAGTATAAACGCCTCTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199133.2-485s21c1
Sequence:CCGGGCAGTACTCGAACGTTGTTATCTCGAGATAACAACGTTCGAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-801s21c1
Sequence:CCGGCTTAGCAAAGGAGCATAATTGCTCGAGCAATTATGCTCCTTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199133
VALIDATED
FAM173B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 173, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-208s1c1
Sequence:CCGGGCCATTTGTACCTGCAACTATCTCGAGATAGTTGCAGGTACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-664s1c1
Sequence:CCGGGCCCTGTACATCGATGCATTTCTCGAGAAATGCATCGATGTACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-1028s1c1
Sequence:CCGGGCCTCGATAAGGAGAAATGATCTCGAGATCATTTCTCCTTATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-521s1c1
Sequence:CCGGCTTGAACGTGAACTTGAGGATCTCGAGATCCTCAAGTTCACGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-512s1c1
Sequence:CCGGGAGAAGAAACTTGAACGTGAACTCGAGTTCACGTTCAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-1184s21c1
Sequence:CCGGGGATTCAGAGAGGCGTTTATACTCGAGTATAAACGCCTCTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199133.2-485s21c1
Sequence:CCGGGCAGTACTCGAACGTTGTTATCTCGAGATAACAACGTTCGAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-801s21c1
Sequence:CCGGCTTAGCAAAGGAGCATAATTGCTCGAGCAATTATGCTCCTTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199133
VALIDATED
FAM173B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 173, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-208s1c1
Sequence:CCGGGCCATTTGTACCTGCAACTATCTCGAGATAGTTGCAGGTACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199133.1-664s1c1
Sequence:CCGGGCCCTGTACATCGATGCATTTCTCGAGAAATGCATCGATGTACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-1028s1c1
Sequence:CCGGGCCTCGATAAGGAGAAATGATCTCGAGATCATTTCTCCTTATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-521s1c1
Sequence:CCGGCTTGAACGTGAACTTGAGGATCTCGAGATCCTCAAGTTCACGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199133.1-512s1c1
Sequence:CCGGGAGAAGAAACTTGAACGTGAACTCGAGTTCACGTTCAAGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-1184s21c1
Sequence:CCGGGGATTCAGAGAGGCGTTTATACTCGAGTATAAACGCCTCTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199133.2-485s21c1
Sequence:CCGGGCAGTACTCGAACGTTGTTATCTCGAGATAACAACGTTCGAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199133.2-801s21c1
Sequence:CCGGCTTAGCAAAGGAGCATAATTGCTCGAGCAATTATGCTCCTTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks