EMAIL THIS PAGE TO A FRIEND

FAM174A

family with sequence similarity 174, member A

91 Gene Product Result for
Synonyms: TMEM157 UNQ1912
UniProtKB ID: Q8TBP5, A8K0H4
Gene ID:
Mouse(67698) family with sequence similarity 174, member A
Rat(301634) family with sequence similarity 174, member A
chicken(427273) family with sequence similarity 174, member A
cow(614659) family with sequence similarity 174, member A
domestic cat(101084085) family with sequence similarity 174, member A
dog(608799) family with sequence similarity 174, member A
sheep(101112055) family with sequence similarity 174, member A
domestic guinea pig(100715654) family with sequence similarity 174, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198507 Rosetta Predictions human pricing
NM_001012350 Rosetta Predictions rat pricing
NM_026321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028838 predicted 562
2 SASI_Hs01_00028839 predicted 1007
3 SASI_Hs01_00028840 predicted 989
4 SASI_Hs01_00028841 predicted 974
5 SASI_Hs01_00028843 predicted 984
6 SASI_Hs01_00028844 predicted 733
7 SASI_Hs01_00028845 predicted 661
8 SASI_Hs02_00372077 predicted 676
9 SASI_Hs01_00028846 predicted 877
10 SASI_Hs01_00028847 predicted 255
11 SASI_Hs01_00028842 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122237 predicted 401
2 SASI_Rn02_00200530 predicted 557
3 SASI_Rn01_00122238 predicted 551
4 SASI_Rn01_00122239 predicted 732
5 SASI_Rn01_00122240 predicted 645
6 SASI_Rn01_00122242 predicted 722
7 SASI_Rn01_00122243 predicted 392
8 SASI_Rn01_00122244 predicted 723
9 SASI_Rn01_00122245 predicted 625
10 SASI_Rn01_00122246 predicted 635
11 SASI_Rn01_00122241 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054896 predicted 904
2 SASI_Mm01_00054897 predicted 675
3 SASI_Mm01_00054898 predicted 904
4 SASI_Mm01_00054899 predicted 663
5 SASI_Mm01_00054900 predicted 822
6 SASI_Mm01_00054901 predicted 726
7 SASI_Mm01_00054902 predicted 853
8 SASI_Mm01_00054903 predicted 746
9 SASI_Mm01_00054904 predicted 685
10 SASI_Mm01_00054905 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026321
VALIDATED
FAM174A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 174, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-718s21c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-681s21c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-671s21c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-624s21c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026321.2-980s1c1
Sequence:CCGGCCATTGTTGTTGCTTTCGTTTCTCGAGAAACGAAAGCAACAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-509s1c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-603s1c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026321.2-556s1c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-566s1c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026321
VALIDATED
FAM174A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 174, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-718s21c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-681s21c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-671s21c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-624s21c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026321.2-980s1c1
Sequence:CCGGCCATTGTTGTTGCTTTCGTTTCTCGAGAAACGAAAGCAACAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-509s1c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-603s1c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026321.2-556s1c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-566s1c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026321
VALIDATED
FAM174A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 174, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-718s21c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-681s21c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-671s21c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026321.4-624s21c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026321.2-980s1c1
Sequence:CCGGCCATTGTTGTTGCTTTCGTTTCTCGAGAAACGAAAGCAACAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-509s1c1
Sequence:CCGGGATGAGAAGAAGAAACCGCAACTCGAGTTGCGGTTTCTTCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-603s1c1
Sequence:CCGGGATGATGACAACACATTGTTTCTCGAGAAACAATGTGTTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026321.2-556s1c1
Sequence:CCGGCGAACATAGAGAACATGGAATCTCGAGATTCCATGTTCTCTATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026321.2-566s1c1
Sequence:CCGGGAACATGGAATTGACACCTTTCTCGAGAAAGGTGTCAATTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198507
VALIDATED
FAM174A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 174, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-757s21c1
Sequence:CCGGAGGAATAAGAAGCCACTATATCTCGAGATATAGTGGCTTCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-673s21c1
Sequence:CCGGGCCAATCATCCTCGAAGATAACTCGAGTTATCTTCGAGGATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-569s21c1
Sequence:CCGGACCGAAAGACTAGGAGATATGCTCGAGCATATCTCCTAGTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-259s21c1
Sequence:CCGGGACCCTAGACCACGGACATTACTCGAGTAATGTCCGTGGTCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198507
VALIDATED
FAM174A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 174, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-757s21c1
Sequence:CCGGAGGAATAAGAAGCCACTATATCTCGAGATATAGTGGCTTCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-673s21c1
Sequence:CCGGGCCAATCATCCTCGAAGATAACTCGAGTTATCTTCGAGGATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-569s21c1
Sequence:CCGGACCGAAAGACTAGGAGATATGCTCGAGCATATCTCCTAGTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-259s21c1
Sequence:CCGGGACCCTAGACCACGGACATTACTCGAGTAATGTCCGTGGTCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198507
VALIDATED
FAM174A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 174, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-757s21c1
Sequence:CCGGAGGAATAAGAAGCCACTATATCTCGAGATATAGTGGCTTCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-673s21c1
Sequence:CCGGGCCAATCATCCTCGAAGATAACTCGAGTTATCTTCGAGGATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-569s21c1
Sequence:CCGGACCGAAAGACTAGGAGATATGCTCGAGCATATCTCCTAGTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198507.1-259s21c1
Sequence:CCGGGACCCTAGACCACGGACATTACTCGAGTAATGTCCGTGGTCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks