EMAIL THIS PAGE TO A FRIEND

FAM174B

family with sequence similarity 174, member B

UniProtKB ID: Q3ZCQ3, Q3ZCR9, Q8NBH7
Gene ID:
Mouse(100038347) family with sequence similarity 174, member B
Rat(681398) family with sequence similarity 174, member B
naked mole-rat(101724685) family with sequence similarity 174, member B
Zebrafish(798908) family with sequence similarity 174, member B
chicken(415505) family with sequence similarity 174, member B
cow(614841) family with sequence similarity 174, member B
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148332 predicted 832
2 SASI_Hs01_00148333 predicted 951
3 SASI_Hs01_00148334 predicted 915
4 SASI_Hs01_00148335 predicted 685
5 SASI_Hs01_00148336 predicted 971
6 SASI_Hs01_00148337 predicted 592
7 SASI_Hs01_00148338 predicted 951
8 SASI_Hs01_00148339 predicted 647
9 SASI_Hs01_00148340 predicted 756
10 SASI_Hs01_00148341 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207446
FAM174B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 174, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207446.1-1257s1c1
Sequence:CCGGCGTGGCTAGTTCACAAAGAATCTCGAGATTCTTTGTGAACTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-589s1c1
Sequence:CCGGCACAGTATTCGACATCAAATACTCGAGTATTTGATGTCGAATACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-490s1c1
Sequence:CCGGGAGGTTAAAGAAGACACGCAACTCGAGTTGCGTGTCTTCTTTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-577s1c1
Sequence:CCGGAGATGAGGACTCCACAGTATTCTCGAGAATACTGTGGAGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-588s1c1
Sequence:CCGGCCACAGTATTCGACATCAAATCTCGAGATTTGATGTCGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-549s21c1
Sequence:CCGGTGGAAATGGCGCCACTAAATGCTCGAGCATTTAGTGGCGCCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-1029s21c1
Sequence:CCGGTATTTAGAATTTCCGACATTCCTCGAGGAATGTCGGAAATTCTAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-916s21c1
Sequence:CCGGAGGGTAGAAACATGTTGATTTCTCGAGAAATCAACATGTTTCTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-426s21c1
Sequence:CCGGTGATCGTGGCGTTCGCCTTTACTCGAGTAAAGGCGAACGCCACGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207446
FAM174B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 174, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207446.1-1257s1c1
Sequence:CCGGCGTGGCTAGTTCACAAAGAATCTCGAGATTCTTTGTGAACTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-589s1c1
Sequence:CCGGCACAGTATTCGACATCAAATACTCGAGTATTTGATGTCGAATACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-490s1c1
Sequence:CCGGGAGGTTAAAGAAGACACGCAACTCGAGTTGCGTGTCTTCTTTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-577s1c1
Sequence:CCGGAGATGAGGACTCCACAGTATTCTCGAGAATACTGTGGAGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-588s1c1
Sequence:CCGGCCACAGTATTCGACATCAAATCTCGAGATTTGATGTCGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-549s21c1
Sequence:CCGGTGGAAATGGCGCCACTAAATGCTCGAGCATTTAGTGGCGCCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-1029s21c1
Sequence:CCGGTATTTAGAATTTCCGACATTCCTCGAGGAATGTCGGAAATTCTAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-916s21c1
Sequence:CCGGAGGGTAGAAACATGTTGATTTCTCGAGAAATCAACATGTTTCTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-426s21c1
Sequence:CCGGTGATCGTGGCGTTCGCCTTTACTCGAGTAAAGGCGAACGCCACGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207446
FAM174B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 174, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207446.1-1257s1c1
Sequence:CCGGCGTGGCTAGTTCACAAAGAATCTCGAGATTCTTTGTGAACTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-589s1c1
Sequence:CCGGCACAGTATTCGACATCAAATACTCGAGTATTTGATGTCGAATACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-490s1c1
Sequence:CCGGGAGGTTAAAGAAGACACGCAACTCGAGTTGCGTGTCTTCTTTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-577s1c1
Sequence:CCGGAGATGAGGACTCCACAGTATTCTCGAGAATACTGTGGAGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207446.1-588s1c1
Sequence:CCGGCCACAGTATTCGACATCAAATCTCGAGATTTGATGTCGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-549s21c1
Sequence:CCGGTGGAAATGGCGCCACTAAATGCTCGAGCATTTAGTGGCGCCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-1029s21c1
Sequence:CCGGTATTTAGAATTTCCGACATTCCTCGAGGAATGTCGGAAATTCTAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207446.2-916s21c1
Sequence:CCGGAGGGTAGAAACATGTTGATTTCTCGAGAAATCAACATGTTTCTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207446.2-426s21c1
Sequence:CCGGTGATCGTGGCGTTCGCCTTTACTCGAGTAAAGGCGAACGCCACGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks