EMAIL THIS PAGE TO A FRIEND

FAM175A

family with sequence similarity 175, member A

66 Gene Product Result for
Synonyms: ABRA1 CCDC98
UniProtKB ID: Q6UWZ7, A5JJ07, Q9H8I1, Q9H9N4
Gene ID:
Mouse(70681) family with sequence similarity 175, member A
Rat(289468) family with sequence similarity 175, member A
Zebrafish(449820) family with sequence similarity 175, member A
domestic cat(101083929) family with sequence similarity 175, member A
cow(504796) family with sequence similarity 175, member A
dog(478459) family with sequence similarity 175, member A
chicken(422608) family with sequence similarity 175, member A
sheep(101109880) family with sequence similarity 175, member A
naked mole-rat(101722678) family with sequence similarity 175, member A
domestic guinea pig(100721329) family with sequence similarity 175, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139076 Rosetta Predictions human pricing
NM_001009633 Rosetta Predictions rat pricing
NM_172405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169393 predicted 1170
2 SASI_Hs01_00169394 predicted 762
3 SASI_Hs01_00169395 predicted 1027
4 SASI_Hs01_00169396 predicted 1062
5 SASI_Hs01_00169398 predicted 679
6 SASI_Hs01_00169399 predicted 1071
7 SASI_Hs01_00169400 predicted 786
8 SASI_Hs01_00169401 predicted 728
9 SASI_Hs01_00169402 predicted 1078
10 SASI_Hs02_00364133 predicted 1115
11 SASI_Hs01_00169397 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199642 predicted 405
2 SASI_Rn02_00199643 predicted 971
3 SASI_Rn01_00034642 predicted 890
4 SASI_Rn01_00034643 predicted 446
5 SASI_Rn01_00034644 predicted 558
6 SASI_Rn01_00034646 predicted 1028
7 SASI_Rn01_00034647 predicted 1011
8 SASI_Rn01_00034648 predicted 674
9 SASI_Rn01_00034649 predicted 532
10 SASI_Rn01_00034650 predicted 395
11 SASI_Rn01_00034645 predicted 759
12 SASI_Rn01_00034651 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020057 predicted 669
2 SASI_Mm01_00020058 predicted 956
3 SASI_Mm01_00020059 predicted 852
4 SASI_Mm01_00020061 predicted 692
5 SASI_Mm01_00020062 predicted 355
6 SASI_Mm02_00343868 predicted 380
7 SASI_Mm01_00020063 predicted 943
8 SASI_Mm01_00020064 predicted 499
9 SASI_Mm01_00020065 predicted 995
10 SASI_Mm01_00020066 predicted 336
11 SASI_Mm01_00020060 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139076
FAM175A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 175, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-686s21c1
Sequence:CCGGATCCTTAAAGGAGGTACATAACTCGAGTTATGTACCTCCTTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-1272s21c1
Sequence:CCGGTATTCACGGTCTCCTACATTTCTCGAGAAATGTAGGAGACCGTGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-546s1c1
Sequence:CCGGCAGTACAAACACACAGCTCTACTCGAGTAGAGCTGTGTGTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-2520s1c1
Sequence:CCGGCCTTGTATGTAACTGGCATAACTCGAGTTATGCCAGTTACATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-404s1c1
Sequence:CCGGCATCGACTGGAACATTCCTTACTCGAGTAAGGAATGTTCCAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139076.1-1007s1c1
Sequence:CCGGGCCTTAGACTTAGATGACAGACTCGAGTCTGTCATCTAAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-1949s1c1
Sequence:CCGGCCAGTGGAACTCAGAACTGATCTCGAGATCAGTTCTGAGTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-480s1c1
Sequence:CCGGGCATGTCTGAACAACTGGGTTCTCGAGAACCCAGTTGTTCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139076.1-2313s1c1
Sequence:CCGGGCAATCTGCTTAATGGACATTCTCGAGAATGTCCATTAAGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139076
FAM175A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 175, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-686s21c1
Sequence:CCGGATCCTTAAAGGAGGTACATAACTCGAGTTATGTACCTCCTTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-1272s21c1
Sequence:CCGGTATTCACGGTCTCCTACATTTCTCGAGAAATGTAGGAGACCGTGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-546s1c1
Sequence:CCGGCAGTACAAACACACAGCTCTACTCGAGTAGAGCTGTGTGTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-2520s1c1
Sequence:CCGGCCTTGTATGTAACTGGCATAACTCGAGTTATGCCAGTTACATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-404s1c1
Sequence:CCGGCATCGACTGGAACATTCCTTACTCGAGTAAGGAATGTTCCAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139076.1-1007s1c1
Sequence:CCGGGCCTTAGACTTAGATGACAGACTCGAGTCTGTCATCTAAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-1949s1c1
Sequence:CCGGCCAGTGGAACTCAGAACTGATCTCGAGATCAGTTCTGAGTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-480s1c1
Sequence:CCGGGCATGTCTGAACAACTGGGTTCTCGAGAACCCAGTTGTTCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139076.1-2313s1c1
Sequence:CCGGGCAATCTGCTTAATGGACATTCTCGAGAATGTCCATTAAGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139076
FAM175A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 175, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-686s21c1
Sequence:CCGGATCCTTAAAGGAGGTACATAACTCGAGTTATGTACCTCCTTTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139076.2-1272s21c1
Sequence:CCGGTATTCACGGTCTCCTACATTTCTCGAGAAATGTAGGAGACCGTGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-546s1c1
Sequence:CCGGCAGTACAAACACACAGCTCTACTCGAGTAGAGCTGTGTGTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-2520s1c1
Sequence:CCGGCCTTGTATGTAACTGGCATAACTCGAGTTATGCCAGTTACATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-404s1c1
Sequence:CCGGCATCGACTGGAACATTCCTTACTCGAGTAAGGAATGTTCCAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139076.1-1007s1c1
Sequence:CCGGGCCTTAGACTTAGATGACAGACTCGAGTCTGTCATCTAAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139076.1-1949s1c1
Sequence:CCGGCCAGTGGAACTCAGAACTGATCTCGAGATCAGTTCTGAGTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139076.1-480s1c1
Sequence:CCGGGCATGTCTGAACAACTGGGTTCTCGAGAACCCAGTTGTTCAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139076.1-2313s1c1
Sequence:CCGGGCAATCTGCTTAATGGACATTCTCGAGAATGTCCATTAAGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172405
VALIDATED
FAM175A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 175, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172405.3-1479s21c1
Sequence:CCGGATGTAGATGCATAGCTATAAACTCGAGTTTATAGCTATGCATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-856s21c1
Sequence:CCGGTGTCAAGCTTTGCGAACATTTCTCGAGAAATGTTCGCAAAGCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.3-417s1c1
Sequence:CCGGGTTGTTAACACCGAGTATAACCTCGAGGTTATACTCGGTGTTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-302s21c1
Sequence:CCGGCTGTGGTGGGTTGGTATAAATCTCGAGATTTATACCAACCCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-538s21c1
Sequence:CCGGTCTGATCAACTGGGTTATAAACTCGAGTTTATAACCCAGTTGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-842s1c1
Sequence:CCGGGAGAACATCCTTCTTTGTCAACTCGAGTTGACAAAGAAGGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-140s1c1
Sequence:CCGGGCCAAGAATAGCATTACTGATCTCGAGATCAGTAATGCTATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-740s1c1
Sequence:CCGGGAGAAACTATTGATGGATGTACTCGAGTACATCCATCAATAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172405
VALIDATED
FAM175A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 175, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172405.3-1479s21c1
Sequence:CCGGATGTAGATGCATAGCTATAAACTCGAGTTTATAGCTATGCATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-856s21c1
Sequence:CCGGTGTCAAGCTTTGCGAACATTTCTCGAGAAATGTTCGCAAAGCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.3-417s1c1
Sequence:CCGGGTTGTTAACACCGAGTATAACCTCGAGGTTATACTCGGTGTTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-302s21c1
Sequence:CCGGCTGTGGTGGGTTGGTATAAATCTCGAGATTTATACCAACCCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-538s21c1
Sequence:CCGGTCTGATCAACTGGGTTATAAACTCGAGTTTATAACCCAGTTGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-842s1c1
Sequence:CCGGGAGAACATCCTTCTTTGTCAACTCGAGTTGACAAAGAAGGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-140s1c1
Sequence:CCGGGCCAAGAATAGCATTACTGATCTCGAGATCAGTAATGCTATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-740s1c1
Sequence:CCGGGAGAAACTATTGATGGATGTACTCGAGTACATCCATCAATAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172405
VALIDATED
FAM175A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 175, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172405.3-1479s21c1
Sequence:CCGGATGTAGATGCATAGCTATAAACTCGAGTTTATAGCTATGCATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-856s21c1
Sequence:CCGGTGTCAAGCTTTGCGAACATTTCTCGAGAAATGTTCGCAAAGCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.3-417s1c1
Sequence:CCGGGTTGTTAACACCGAGTATAACCTCGAGGTTATACTCGGTGTTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-302s21c1
Sequence:CCGGCTGTGGTGGGTTGGTATAAATCTCGAGATTTATACCAACCCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172405.3-538s21c1
Sequence:CCGGTCTGATCAACTGGGTTATAAACTCGAGTTTATAACCCAGTTGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-842s1c1
Sequence:CCGGGAGAACATCCTTCTTTGTCAACTCGAGTTGACAAAGAAGGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-140s1c1
Sequence:CCGGGCCAAGAATAGCATTACTGATCTCGAGATCAGTAATGCTATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172405.1-740s1c1
Sequence:CCGGGAGAAACTATTGATGGATGTACTCGAGTACATCCATCAATAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks