EMAIL THIS PAGE TO A FRIEND

FAM175B

family with sequence similarity 175, member B

154 Gene Product Result for
Synonyms: ABRO1 KIAA0157
UniProtKB ID: Q15018, B4DKR2, Q96H11
Gene ID:
Mouse(109359) family with sequence similarity 175, member B
Rat(293570) family with sequence similarity 175, member B
domestic guinea pig(100734687) family with sequence similarity 175, member B
naked mole-rat(101725340) family with sequence similarity 175, member B
sheep(101114481) family with sequence similarity 175, member B
Zebrafish(406584) family with sequence similarity 175, member B
cow(510233) family with sequence similarity 175, member B
domestic cat(101098657) family with sequence similarity 175, member B
dog(477859) family with sequence similarity 175, member B
chicken(423954) family with sequence similarity 175, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032182 Rosetta Predictions human pricing
NM_001106307 Rosetta Predictions rat pricing
NM_198017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150018 predicted 522
2 SASI_Hs02_00359452 predicted 276
3 SASI_Hs01_00150019 predicted 604
4 SASI_Hs02_00359453 predicted 307
5 SASI_Hs01_00150020 predicted 775
6 SASI_Hs01_00150021 predicted 480
7 SASI_Hs02_00359454 predicted 257
8 SASI_Hs01_00150022 predicted 518
9 SASI_Hs01_00150023 predicted 814
10 SASI_Hs02_00359455 predicted 275
11 SASI_Hs01_00150024 predicted 457
12 SASI_Hs01_00150025 predicted 1121
13 SASI_Hs01_00150026 predicted 948
14 SASI_Hs01_00150027 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217688 predicted 566
2 SASI_Rn02_00217689 predicted 1135
3 SASI_Rn02_00217690 predicted 966
4 SASI_Rn02_00217691 predicted 436
5 SASI_Rn02_00217692 predicted 1183
6 SASI_Rn02_00217693 predicted 1189
7 SASI_Rn02_00217694 predicted 1208
8 SASI_Rn02_00217695 predicted 414
9 SASI_Rn02_00217696 predicted 946
10 SASI_Rn02_00217697 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042784 predicted 583
2 SASI_Mm01_00042785 predicted 564
3 SASI_Mm01_00042786 predicted 587
4 SASI_Mm01_00042787 predicted 1200
5 SASI_Mm01_00042788 predicted 1194
6 SASI_Mm01_00042789 predicted 598
7 SASI_Mm01_00042790 predicted 1146
8 SASI_Mm02_00350727 predicted 265
9 SASI_Mm01_00042791 predicted 806
10 SASI_Mm01_00042792 predicted 446
11 SASI_Mm01_00042793 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198017
VALIDATED
FAM175B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 175, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-637s1c1
Sequence:CCGGCGGATGTCCTATTCTGGGTTTCTCGAGAAACCCAGAATAGGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-248s1c1
Sequence:CCGGGCAGGTATAATCAAAGGATATCTCGAGATATCCTTTGATTATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-482s21c1
Sequence:CCGGAGACCAAACCGCAGGTATAATCTCGAGATTATACCTGCGGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-586s21c1
Sequence:CCGGGAGTTATGCCAAGGTCATTAACTCGAGTTAATGACCTTGGCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-1756s21c1
Sequence:CCGGTAATTCCAAGAAGCCTAATTGCTCGAGCAATTAGGCTTCTTGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.2-519s1c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198017.2-1853s1c1
Sequence:CCGGCTACTAGCCTGATACGTATTGCTCGAGCAATACGTATCAGGCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198017.2-519s21c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-646s21c1
Sequence:CCGGGAAGGACATCAGGGCAATTTACTCGAGTAAATTGCCCTGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198017
VALIDATED
FAM175B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 175, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-637s1c1
Sequence:CCGGCGGATGTCCTATTCTGGGTTTCTCGAGAAACCCAGAATAGGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-248s1c1
Sequence:CCGGGCAGGTATAATCAAAGGATATCTCGAGATATCCTTTGATTATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-482s21c1
Sequence:CCGGAGACCAAACCGCAGGTATAATCTCGAGATTATACCTGCGGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-586s21c1
Sequence:CCGGGAGTTATGCCAAGGTCATTAACTCGAGTTAATGACCTTGGCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-1756s21c1
Sequence:CCGGTAATTCCAAGAAGCCTAATTGCTCGAGCAATTAGGCTTCTTGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.2-519s1c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198017.2-1853s1c1
Sequence:CCGGCTACTAGCCTGATACGTATTGCTCGAGCAATACGTATCAGGCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198017.2-519s21c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-646s21c1
Sequence:CCGGGAAGGACATCAGGGCAATTTACTCGAGTAAATTGCCCTGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198017
VALIDATED
FAM175B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 175, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-637s1c1
Sequence:CCGGCGGATGTCCTATTCTGGGTTTCTCGAGAAACCCAGAATAGGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.1-248s1c1
Sequence:CCGGGCAGGTATAATCAAAGGATATCTCGAGATATCCTTTGATTATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-482s21c1
Sequence:CCGGAGACCAAACCGCAGGTATAATCTCGAGATTATACCTGCGGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-586s21c1
Sequence:CCGGGAGTTATGCCAAGGTCATTAACTCGAGTTAATGACCTTGGCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-1756s21c1
Sequence:CCGGTAATTCCAAGAAGCCTAATTGCTCGAGCAATTAGGCTTCTTGGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198017.2-519s1c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198017.2-1853s1c1
Sequence:CCGGCTACTAGCCTGATACGTATTGCTCGAGCAATACGTATCAGGCTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198017.2-519s21c1
Sequence:CCGGCTATTCCCAATCTAGGCAATACTCGAGTATTGCCTAGATTGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198017.2-646s21c1
Sequence:CCGGGAAGGACATCAGGGCAATTTACTCGAGTAAATTGCCCTGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032182
VALIDATED
FAM175B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 175, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-978s1c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-473s1c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-616s1c1
Sequence:CCGGGAAAGACATCAGGGCGATTTACTCGAGTAAATCGCCCTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032182.2-1676s1c1
Sequence:CCGGGCAGCCTTCAAAGAACTTCTTCTCGAGAAGAAGTTCTTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-1158s1c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-1196s21c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032182.3-1016s21c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032182.3-1523s21c1
Sequence:CCGGTGGTGCGATTCATGGATATACCTCGAGGTATATCCATGAATCGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-665s21c1
Sequence:CCGGGGGCGATTTATCAGGTTTATACTCGAGTATAAACCTGATAAATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-511s21c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032182
VALIDATED
FAM175B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 175, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-978s1c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-473s1c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-616s1c1
Sequence:CCGGGAAAGACATCAGGGCGATTTACTCGAGTAAATCGCCCTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032182.2-1676s1c1
Sequence:CCGGGCAGCCTTCAAAGAACTTCTTCTCGAGAAGAAGTTCTTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-1158s1c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-1196s21c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032182.3-1016s21c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032182.3-1523s21c1
Sequence:CCGGTGGTGCGATTCATGGATATACCTCGAGGTATATCCATGAATCGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-665s21c1
Sequence:CCGGGGGCGATTTATCAGGTTTATACTCGAGTATAAACCTGATAAATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-511s21c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032182
VALIDATED
FAM175B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 175, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-978s1c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032182.2-473s1c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-616s1c1
Sequence:CCGGGAAAGACATCAGGGCGATTTACTCGAGTAAATCGCCCTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032182.2-1676s1c1
Sequence:CCGGGCAGCCTTCAAAGAACTTCTTCTCGAGAAGAAGTTCTTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032182.2-1158s1c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-1196s21c1
Sequence:CCGGCAGAGCCTTCTAATAGTGAATCTCGAGATTCACTATTAGAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032182.3-1016s21c1
Sequence:CCGGGCATGGAAAGGAGTGTCTTTACTCGAGTAAAGACACTCCTTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032182.3-1523s21c1
Sequence:CCGGTGGTGCGATTCATGGATATACCTCGAGGTATATCCATGAATCGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-665s21c1
Sequence:CCGGGGGCGATTTATCAGGTTTATACTCGAGTATAAACCTGATAAATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032182.3-511s21c1
Sequence:CCGGCAGAGGATATCACTCGCTATTCTCGAGAATAGCGAGTGATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks