EMAIL THIS PAGE TO A FRIEND

FAM177A1

family with sequence similarity 177, member A1

35 Gene Product Result for
Synonyms: C14orf24
UniProtKB ID: Q8N128, Q68CT2
Gene ID:
Rat(100359558) family with sequence similarity 177, member A1
sheep(101119166) family with sequence similarity 177, member A1
naked mole-rat(101712018) family with sequence similarity 177, member A1
domestic guinea pig(100718408) family with sequence similarity 177, member A1
Zebrafish(100126028) family with sequence similarity 177, member A1
chicken(423323) family with sequence similarity 177, member A1
cow(100125286) family with sequence similarity 177, member A1
domestic cat(101083855) family with sequence similarity 177, member A1
dog(100686710) family with sequence similarity 177, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173607 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079519 Rosetta Predictions human pricing
NM_173607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313420 predicted 627
2 SASI_Hs02_00313421 predicted 1525
3 SASI_Hs02_00313422 predicted 1547
4 SASI_Hs02_00313423 predicted 1441
5 SASI_Hs02_00313424 predicted 1524
6 SASI_Hs02_00313425 predicted 1309
7 SASI_Hs02_00313426 predicted 1385
8 SASI_Hs02_00313427 predicted 994
9 SASI_Hs02_00313428 predicted 1383
10 SASI_Hs02_00313429 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090048 predicted 294
2 SASI_Hs02_00368468 predicted 1188
3 SASI_Hs01_00090040 predicted 1218
4 SASI_Hs01_00090041 predicted 1107
5 SASI_Hs01_00090042 predicted 1191
6 SASI_Hs01_00090043 predicted 974
7 SASI_Hs01_00090046 predicted 1056
8 SASI_Hs01_00090047 predicted 669
9 SASI_Hs02_00368469 predicted 74
10 SASI_Hs01_00090049 predicted 1053
11 SASI_Hs01_00090044 predicted 248
12 SASI_Hs01_00090045 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173607
VALIDATED
FAM177A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 177, member A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1303s1c1
Sequence:CCGGGCAAGCCACTTACTTAATCTTCTCGAGAAGATTAAGTAAGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1566s1c1
Sequence:CCGGCCCGTCATTCATCATTTAGAACTCGAGTTCTAAATGATGAATGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-622s1c1
Sequence:CCGGCAGCTCATTTGTGAATGTCAACTCGAGTTGACATTCACAAATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1553s1c1
Sequence:CCGGCCTAATGAAATTACCCGTCATCTCGAGATGACGGGTAATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-171s1c1
Sequence:CCGGGTAACGAAAGAGGCTTTGAAACTCGAGTTTCAAAGCCTCTTTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-457s1c1
Sequence:CCGGCCCAAAGTACCAATATGCCATCTCGAGATGGCATATTGGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-581s1c1
Sequence:CCGGGATTCCATTGTTCAGACAGATCTCGAGATCTGTCTGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-599s1c1
Sequence:CCGGGATCAACCAGAGACAGTGATACTCGAGTATCACTGTCTCTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1199s1c1
Sequence:CCGGGCAAGATGGAAGCACTTTGAACTCGAGTTCAAAGTGCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173607
VALIDATED
FAM177A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 177, member A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1303s1c1
Sequence:CCGGGCAAGCCACTTACTTAATCTTCTCGAGAAGATTAAGTAAGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1566s1c1
Sequence:CCGGCCCGTCATTCATCATTTAGAACTCGAGTTCTAAATGATGAATGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-622s1c1
Sequence:CCGGCAGCTCATTTGTGAATGTCAACTCGAGTTGACATTCACAAATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1553s1c1
Sequence:CCGGCCTAATGAAATTACCCGTCATCTCGAGATGACGGGTAATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-171s1c1
Sequence:CCGGGTAACGAAAGAGGCTTTGAAACTCGAGTTTCAAAGCCTCTTTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-457s1c1
Sequence:CCGGCCCAAAGTACCAATATGCCATCTCGAGATGGCATATTGGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-581s1c1
Sequence:CCGGGATTCCATTGTTCAGACAGATCTCGAGATCTGTCTGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-599s1c1
Sequence:CCGGGATCAACCAGAGACAGTGATACTCGAGTATCACTGTCTCTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1199s1c1
Sequence:CCGGGCAAGATGGAAGCACTTTGAACTCGAGTTCAAAGTGCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173607
VALIDATED
FAM177A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 177, member A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1303s1c1
Sequence:CCGGGCAAGCCACTTACTTAATCTTCTCGAGAAGATTAAGTAAGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1566s1c1
Sequence:CCGGCCCGTCATTCATCATTTAGAACTCGAGTTCTAAATGATGAATGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-622s1c1
Sequence:CCGGCAGCTCATTTGTGAATGTCAACTCGAGTTGACATTCACAAATGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173607.2-1553s1c1
Sequence:CCGGCCTAATGAAATTACCCGTCATCTCGAGATGACGGGTAATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-171s1c1
Sequence:CCGGGTAACGAAAGAGGCTTTGAAACTCGAGTTTCAAAGCCTCTTTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-457s1c1
Sequence:CCGGCCCAAAGTACCAATATGCCATCTCGAGATGGCATATTGGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173607.2-581s1c1
Sequence:CCGGGATTCCATTGTTCAGACAGATCTCGAGATCTGTCTGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173607.2-599s1c1
Sequence:CCGGGATCAACCAGAGACAGTGATACTCGAGTATCACTGTCTCTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173607.2-1199s1c1
Sequence:CCGGGCAAGATGGAAGCACTTTGAACTCGAGTTCAAAGTGCTTCCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks