EMAIL THIS PAGE TO A FRIEND

FAM178A

family with sequence similarity 178, member A

269 Gene Product Result for
Synonyms: C10orf6
UniProtKB ID: Q8IX21, A8K950, B1AL17, Q5W0L8, Q9NPE8
Gene ID:
Mouse(226151) family with sequence similarity 178, member A
Rat(499360) family with sequence similarity 178, member A
sheep(101122318) family with sequence similarity 178, member A
domestic guinea pig(101787861) family with sequence similarity 178, member A
naked mole-rat(101717634) family with sequence similarity 178, member A
Zebrafish(100320914) family with sequence similarity 178, member A
cow(541239) family with sequence similarity 178, member A
domestic cat(101093049) family with sequence similarity 178, member A
dog(612816) family with sequence similarity 178, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018121 Rosetta Predictions human pricing
NM_001134612 Rosetta Predictions rat pricing
NM_001081225 Rosetta Predictions mouse pricing
XM_484809 Rosetta Predictions mouse pricing
XM_901708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010374 predicted 3398
2 SASI_Hs02_00351330 predicted 3947
3 SASI_Hs01_00010375 predicted 1279
4 SASI_Hs02_00351331 predicted 2171
5 SASI_Hs01_00010376 predicted 2913
6 SASI_Hs01_00010377 predicted 2121
7 SASI_Hs01_00010378 predicted 953
8 SASI_Hs01_00010379 predicted 1687
9 SASI_Hs01_00010380 predicted 1830
10 SASI_Hs01_00010381 predicted 3656
11 SASI_Hs01_00010373 predicted 3830
12 SASI_Hs01_00010382 predicted 2847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257599 predicted 3496
2 SASI_Rn02_00257600 predicted 1154
3 SASI_Rn02_00257601 predicted 2422
4 SASI_Rn02_00257602 predicted 592
5 SASI_Rn02_00257603 predicted 334
6 SASI_Rn02_00257604 predicted 2313
7 SASI_Rn02_00257605 predicted 3312
8 SASI_Rn02_00257606 predicted 2721
9 SASI_Rn02_00257607 predicted 2849
10 SASI_Rn02_00257608 predicted 3257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296411 predicted 1148
2 SASI_Mm02_00296412 predicted 2423
3 SASI_Mm02_00296413 predicted 614
4 SASI_Mm02_00296414 predicted 2844
5 SASI_Mm02_00296415 predicted 2851
6 SASI_Mm02_00296416 predicted 822
7 SASI_Mm02_00296417 predicted 3420
8 SASI_Mm02_00296418 predicted 2662
9 SASI_Mm02_00296419 predicted 2718
10 SASI_Mm02_00296420 predicted 2148
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244139 predicted 3577
2 SASI_Mm01_00244140 predicted 2425
3 SASI_Mm01_00244141 predicted 2671
4 SASI_Mm01_00244142 predicted 2849
5 SASI_Mm01_00244143 predicted 2859
6 SASI_Mm01_00244144 predicted 3575
7 SASI_Mm01_00244145 predicted 3425
8 SASI_Mm01_00244146 predicted 2343
9 SASI_Mm01_00244147 predicted 2660
10 SASI_Mm01_00244148 predicted 2717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239037 predicted 4050
2 SASI_Mm01_00239038 predicted 2897
3 SASI_Mm01_00239039 predicted 3136
4 SASI_Mm01_00239040 predicted 3322
5 SASI_Mm01_00239041 predicted 3330
6 SASI_Mm01_00239042 predicted 4041
7 SASI_Mm01_00239043 predicted 3904
8 SASI_Mm01_00239044 predicted 2819
9 SASI_Mm01_00239045 predicted 3133
10 SASI_Mm01_00239046 predicted 3188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018121
VALIDATED
FAM178A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 178, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-3483s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-678s21c1
Sequence:CCGGGACAGGAAGCAGTCAATTATACTCGAGTATAATTGACTGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-2920s21c1
Sequence:CCGGTTACGTCTGCTTATCACTATGCTCGAGCATAGTGATAAGCAGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-1316s1c1
Sequence:CCGGGCAGAGAATCAACTCCGAGAACTCGAGTTCTCGGAGTTGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2955s1c1
Sequence:CCGGCCTGTGTTAAAGTGGCTGTTTCTCGAGAAACAGCCACTTTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-906s1c1
Sequence:CCGGCACCATGAAGATCATGGTATACTCGAGTATACCATGATCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-3739s1c1
Sequence:CCGGCTGAACAACCAGATGGCATTACTCGAGTAATGCCATCTGGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2179s1c1
Sequence:CCGGGCTCAGAATATGGCACTCCTACTCGAGTAGGAGTGCCATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018121
VALIDATED
FAM178A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 178, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-3483s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-678s21c1
Sequence:CCGGGACAGGAAGCAGTCAATTATACTCGAGTATAATTGACTGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-2920s21c1
Sequence:CCGGTTACGTCTGCTTATCACTATGCTCGAGCATAGTGATAAGCAGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-1316s1c1
Sequence:CCGGGCAGAGAATCAACTCCGAGAACTCGAGTTCTCGGAGTTGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2955s1c1
Sequence:CCGGCCTGTGTTAAAGTGGCTGTTTCTCGAGAAACAGCCACTTTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-906s1c1
Sequence:CCGGCACCATGAAGATCATGGTATACTCGAGTATACCATGATCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-3739s1c1
Sequence:CCGGCTGAACAACCAGATGGCATTACTCGAGTAATGCCATCTGGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2179s1c1
Sequence:CCGGGCTCAGAATATGGCACTCCTACTCGAGTAGGAGTGCCATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018121
VALIDATED
FAM178A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 178, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-3483s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-678s21c1
Sequence:CCGGGACAGGAAGCAGTCAATTATACTCGAGTATAATTGACTGCTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018121.3-2920s21c1
Sequence:CCGGTTACGTCTGCTTATCACTATGCTCGAGCATAGTGATAAGCAGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-1316s1c1
Sequence:CCGGGCAGAGAATCAACTCCGAGAACTCGAGTTCTCGGAGTTGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2955s1c1
Sequence:CCGGCCTGTGTTAAAGTGGCTGTTTCTCGAGAAACAGCCACTTTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-906s1c1
Sequence:CCGGCACCATGAAGATCATGGTATACTCGAGTATACCATGATCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018121.2-3739s1c1
Sequence:CCGGCTGAACAACCAGATGGCATTACTCGAGTAATGCCATCTGGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018121.2-2179s1c1
Sequence:CCGGGCTCAGAATATGGCACTCCTACTCGAGTAGGAGTGCCATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081225
VALIDATED
FAM178A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 178, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2860s21c1
Sequence:CCGGTCACCTTATAGTCCAGTATTTCTCGAGAAATACTGGACTATAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2648s21c1
Sequence:CCGGCATTGATGGAAATAACCATTACTCGAGTAATGGTTATTTCCATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-506s21c1
Sequence:CCGGCATCAGAAGAAAGTCCTATTTCTCGAGAAATAGGACTTTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-3103s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-5272s21c1
Sequence:CCGGTAGATACGAAGAGCTATATTTCTCGAGAAATATAGCTCTTCGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081225
VALIDATED
FAM178A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 178, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2860s21c1
Sequence:CCGGTCACCTTATAGTCCAGTATTTCTCGAGAAATACTGGACTATAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2648s21c1
Sequence:CCGGCATTGATGGAAATAACCATTACTCGAGTAATGGTTATTTCCATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-506s21c1
Sequence:CCGGCATCAGAAGAAAGTCCTATTTCTCGAGAAATAGGACTTTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-3103s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-5272s21c1
Sequence:CCGGTAGATACGAAGAGCTATATTTCTCGAGAAATATAGCTCTTCGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081225
VALIDATED
FAM178A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 178, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2860s21c1
Sequence:CCGGTCACCTTATAGTCCAGTATTTCTCGAGAAATACTGGACTATAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-2648s21c1
Sequence:CCGGCATTGATGGAAATAACCATTACTCGAGTAATGGTTATTTCCATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-506s21c1
Sequence:CCGGCATCAGAAGAAAGTCCTATTTCTCGAGAAATAGGACTTTCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-3103s21c1
Sequence:CCGGGAACTCTGTCTGGGCATAAATCTCGAGATTTATGCCCAGACAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081225.1-5272s21c1
Sequence:CCGGTAGATACGAAGAGCTATATTTCTCGAGAAATATAGCTCTTCGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks