EMAIL THIS PAGE TO A FRIEND

FAM178B

family with sequence similarity 178, member B

85 Gene Product Result for
UniProtKB ID: Q8IXR5, A8MXN2, E9PD86, Q8IUY0, Q9P0P4
Gene ID:
Mouse(381337) family with sequence similarity 178, member B
Rat(501125) family with sequence similarity 178, member B
chicken(425134) family with sequence similarity 178, member B
domestic cat(101091012) family with sequence similarity 178, member B
cow(618158) family with sequence similarity 178, member B
dog(611701) family with sequence similarity 178, member B
naked mole-rat(101717960) family with sequence similarity 178, member B
domestic guinea pig(100713752) family with sequence similarity 178, member B
sheep(101113141) family with sequence similarity 178, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001122646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001122646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001122646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122646 Rosetta Predictions human pricing
NM_016490 Rosetta Predictions human pricing
NM_001122658 Rosetta Predictions rat pricing
NM_001126046 Rosetta Predictions mouse pricing
NM_027957 Rosetta Predictions mouse pricing
NM_201365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327136 predicted 2314
2 SASI_Hs02_00327137 predicted 2345
3 SASI_Hs02_00327138 predicted 2273
4 SASI_Hs02_00327139 predicted 2366
5 SASI_Hs02_00327140 predicted 2385
6 SASI_Hs02_00327141 predicted 2167
7 SASI_Hs02_00327142 predicted 2116
8 SASI_Hs02_00327143 predicted 2200
9 SASI_Hs02_00327144 predicted 2120
10 SASI_Hs02_00327145 predicted 2318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349550 predicted 593
2 SASI_Hs01_00066498 predicted 629
3 SASI_Hs01_00066500 predicted 553
4 SASI_Hs02_00349551 predicted 655
5 SASI_Hs02_00349552 predicted 663
6 SASI_Hs02_00349553 predicted 445
7 SASI_Hs02_00349554 predicted 400
8 SASI_Hs02_00349555 predicted 471
9 SASI_Hs02_00349556 predicted 404
10 SASI_Hs02_00349557 predicted 598
11 SASI_Hs01_00066497 predicted 265
12 SASI_Hs01_00066499 predicted 214
13 SASI_Hs01_00066501 predicted 347
14 SASI_Hs01_00066502 predicted 232
15 SASI_Hs01_00066503 predicted 363
16 SASI_Hs01_00066504 predicted 304
17 SASI_Hs01_00066505 predicted 245
18 SASI_Hs01_00066506 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252673 predicted 783
2 SASI_Rn02_00252674 predicted 1167
3 SASI_Rn02_00252675 predicted 450
4 SASI_Rn02_00252676 predicted 572
5 SASI_Rn02_00252677 predicted 667
6 SASI_Rn02_00252678 predicted 586
7 SASI_Rn02_00252679 predicted 1278
8 SASI_Rn02_00252680 predicted 1089
9 SASI_Rn02_00252681 predicted 840
10 SASI_Rn02_00252682 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309895 predicted 1833
2 SASI_Mm02_00309896 predicted 1780
3 SASI_Mm02_00309897 predicted 1818
4 SASI_Mm02_00309898 predicted 1890
5 SASI_Mm02_00309899 predicted 1820
6 SASI_Mm02_00309900 predicted 1881
7 SASI_Mm02_00309901 predicted 1898
8 SASI_Mm02_00309902 predicted 1930
9 SASI_Mm02_00309903 predicted 1833
10 SASI_Mm02_00309904 predicted 1836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332973 predicted 460
2 SASI_Mm02_00332974 predicted 399
3 SASI_Mm02_00332975 predicted 439
4 SASI_Mm02_00332976 predicted 520
5 SASI_Mm02_00332977 predicted 442
6 SASI_Mm02_00332978 predicted 501
7 SASI_Mm02_00332979 predicted 515
8 SASI_Mm02_00332980 predicted 546
9 SASI_Mm02_00332981 predicted 459
10 SASI_Mm02_00332982 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108270 predicted 1205
2 SASI_Mm01_00108271 predicted 742
3 SASI_Mm02_00351522 predicted 1192
4 SASI_Mm01_00108272 predicted 964
5 SASI_Mm01_00108273 predicted 660
6 SASI_Mm01_00108274 predicted 651
7 SASI_Mm01_00108275 predicted 1057
8 SASI_Mm01_00108277 predicted 1027
9 SASI_Mm01_00108278 predicted 1243
10 SASI_Mm01_00108279 predicted 660
11 SASI_Mm01_00108276 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201365
FAM178B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 178, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-872s1c1
Sequence:CCGGCAGAAACATCTTCAAGAGCTTCTCGAGAAGCTCTTGAAGATGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-901s1c1
Sequence:CCGGCTCTGGGATCTCAGTATAGATCTCGAGATCTATACTGAGATCCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-936s1c1
Sequence:CCGGGCCTGATGAAGACATGCATTTCTCGAGAAATGCATGTCTTCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-841s1c1
Sequence:CCGGCAGTGGCTGTTCCAGTTGTTACTCGAGTAACAACTGGAACAGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201365
FAM178B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 178, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-872s1c1
Sequence:CCGGCAGAAACATCTTCAAGAGCTTCTCGAGAAGCTCTTGAAGATGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-901s1c1
Sequence:CCGGCTCTGGGATCTCAGTATAGATCTCGAGATCTATACTGAGATCCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-936s1c1
Sequence:CCGGGCCTGATGAAGACATGCATTTCTCGAGAAATGCATGTCTTCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-841s1c1
Sequence:CCGGCAGTGGCTGTTCCAGTTGTTACTCGAGTAACAACTGGAACAGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201365
FAM178B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 178, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-872s1c1
Sequence:CCGGCAGAAACATCTTCAAGAGCTTCTCGAGAAGCTCTTGAAGATGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-901s1c1
Sequence:CCGGCTCTGGGATCTCAGTATAGATCTCGAGATCTATACTGAGATCCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-936s1c1
Sequence:CCGGGCCTGATGAAGACATGCATTTCTCGAGAAATGCATGTCTTCATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201365.1-841s1c1
Sequence:CCGGCAGTGGCTGTTCCAGTTGTTACTCGAGTAACAACTGGAACAGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122646
FAM178B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 178, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-844s21c1
Sequence:CCGGTCAACAACCTGGACTACTTACCTCGAGGTAAGTAGTCCAGGTTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1937s21c1
Sequence:CCGGGCCATCATCTCTCAGGCAATACTCGAGTATTGCCTGAGAGATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1254s21c1
Sequence:CCGGTGGCCTCCAGAAACATCTTTGCTCGAGCAAAGATGTTTCTGGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1285s21c1
Sequence:CCGGGTCTTCTGTGGGATCTCATTGCTCGAGCAATGAGATCCCACAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122646.1-2354s21c1
Sequence:CCGGACTGGAGGAAGCGAAGCATCACTCGAGTGATGCTTCGCTTCCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122646
FAM178B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 178, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-844s21c1
Sequence:CCGGTCAACAACCTGGACTACTTACCTCGAGGTAAGTAGTCCAGGTTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1937s21c1
Sequence:CCGGGCCATCATCTCTCAGGCAATACTCGAGTATTGCCTGAGAGATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1254s21c1
Sequence:CCGGTGGCCTCCAGAAACATCTTTGCTCGAGCAAAGATGTTTCTGGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1285s21c1
Sequence:CCGGGTCTTCTGTGGGATCTCATTGCTCGAGCAATGAGATCCCACAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122646.1-2354s21c1
Sequence:CCGGACTGGAGGAAGCGAAGCATCACTCGAGTGATGCTTCGCTTCCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122646
FAM178B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 178, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-844s21c1
Sequence:CCGGTCAACAACCTGGACTACTTACCTCGAGGTAAGTAGTCCAGGTTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1937s21c1
Sequence:CCGGGCCATCATCTCTCAGGCAATACTCGAGTATTGCCTGAGAGATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1254s21c1
Sequence:CCGGTGGCCTCCAGAAACATCTTTGCTCGAGCAAAGATGTTTCTGGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122646.1-1285s21c1
Sequence:CCGGGTCTTCTGTGGGATCTCATTGCTCGAGCAATGAGATCCCACAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122646.1-2354s21c1
Sequence:CCGGACTGGAGGAAGCGAAGCATCACTCGAGTGATGCTTCGCTTCCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)