EMAIL THIS PAGE TO A FRIEND

FAM179A

family with sequence similarity 179, member A

73 Gene Product Result for
UniProtKB ID: Q6ZUX3, Q6ZUF5
Gene ID:
Mouse(320159) family with sequence similarity 179, member A
Rat(313892) family with sequence similarity 179, member A
sheep(101113576) family with sequence similarity 179, member A
domestic guinea pig(100731757) family with sequence similarity 179, member A
naked mole-rat(101699882) family with sequence similarity 179, member A
chicken(421296) family with sequence similarity 179, member A
cow(100298060) family with sequence similarity 179, member A
domestic cat(101089346) family with sequence similarity 179, member A
dog(483018) family with sequence similarity 179, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199280 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015151 MISSION® esiRNA esiRNA targeting mouse Fam179a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199280 Rosetta Predictions human pricing
XM_001067322 Rosetta Predictions rat pricing
XM_233869 Rosetta Predictions rat pricing
NM_177087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372693 predicted 2379
2 SASI_Hs02_00372694 predicted 2465
3 SASI_Hs02_00372695 predicted 995
4 SASI_Hs02_00372696 predicted 1791
5 SASI_Hs02_00372697 predicted 715
6 SASI_Hs02_00372698 predicted 1322
7 SASI_Hs02_00372699 predicted 1767
8 SASI_Hs02_00372700 predicted 2430
9 SASI_Hs02_00372701 predicted 3146
10 SASI_Hs02_00372702 predicted 1609
11 SASI_Hs01_00195163 predicted 1245
12 SASI_Hs01_00195164 predicted 101
13 SASI_Hs01_00195165 predicted 33
14 SASI_Hs01_00195166 predicted 72
15 SASI_Hs01_00195167 predicted 690
16 SASI_Hs01_00195168 predicted 700
17 SASI_Hs01_00195169 predicted 1205
18 SASI_Hs01_00195170 predicted 619
19 SASI_Hs01_00195171 predicted 483
20 SASI_Hs01_00195172 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320665 predicted 2223
2 SASI_Rn02_00320666 predicted 791
3 SASI_Rn02_00320667 predicted 1477
4 SASI_Rn02_00320668 predicted 495
5 SASI_Rn02_00320669 predicted 2149
6 SASI_Rn02_00320670 predicted 2204
7 SASI_Rn02_00320671 predicted 984
8 SASI_Rn02_00320672 predicted 1621
9 SASI_Rn02_00320673 predicted 767
10 SASI_Rn02_00320674 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388110 predicted 2224
2 SASI_Rn02_00388111 predicted 792
3 SASI_Rn02_00388112 predicted 1476
4 SASI_Rn02_00388113 predicted 500
5 SASI_Rn02_00388114 predicted 2149
6 SASI_Rn02_00388115 predicted 2210
7 SASI_Rn02_00388116 predicted 983
8 SASI_Rn02_00388117 predicted 1622
9 SASI_Rn02_00388118 predicted 772
10 SASI_Rn02_00388119 predicted 2257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347073 predicted 2436
2 SASI_Mm02_00347074 predicted 1709
3 SASI_Mm02_00347075 predicted 2477
4 SASI_Mm02_00347076 predicted 1852
5 SASI_Mm02_00347077 predicted 2399
6 SASI_Mm02_00347078 predicted 1300
7 SASI_Mm02_00347079 predicted 1938
8 SASI_Mm02_00347080 predicted 1230
9 SASI_Mm02_00347081 predicted 487
10 SASI_Mm02_00347082 predicted 1214
11 SASI_Mm01_00067736 predicted 2401
12 SASI_Mm01_00067737 predicted 2705
13 SASI_Mm01_00067738 predicted 2706
14 SASI_Mm01_00067739 predicted 2395
15 SASI_Mm01_00067740 predicted 2545
16 SASI_Mm01_00067741 predicted 2756
17 SASI_Mm01_00067742 predicted 2972
18 SASI_Mm01_00067743 predicted 2397
19 SASI_Mm01_00067744 predicted 2625
20 SASI_Mm01_00067745 predicted 2353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177087
FAM179A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 179, member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.4-1029s1c1
Sequence:CCGGGAGAAGATGCACAAGTCTTTACTCGAGTAAAGACTTGTGCATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2681s1c1
Sequence:CCGGGCAGTGCTGGATATCACAGATCTCGAGATCTGTGATATCCAGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2977s1c1
Sequence:CCGGCAAGGTCATAGGTGGAAGAATCTCGAGATTCTTCCACCTATGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2690s1c1
Sequence:CCGGGATATCACAGATCGCCTCTCACTCGAGTGAGAGGCGATCTGTGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2773s1c1
Sequence:CCGGCCTCTGGTACTTCCTGAACAACTCGAGTTGTTCAGGAAGTACCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2442s1c1
Sequence:CCGGCCAACAAGAAAGTGAACCAGTCTCGAGACTGGTTCACTTTCTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2350s1c1
Sequence:CCGGGAAGCTCCTTGAGTACTGCAACTCGAGTTGCAGTACTCAAGGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177087
FAM179A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 179, member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.4-1029s1c1
Sequence:CCGGGAGAAGATGCACAAGTCTTTACTCGAGTAAAGACTTGTGCATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2681s1c1
Sequence:CCGGGCAGTGCTGGATATCACAGATCTCGAGATCTGTGATATCCAGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2977s1c1
Sequence:CCGGCAAGGTCATAGGTGGAAGAATCTCGAGATTCTTCCACCTATGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2690s1c1
Sequence:CCGGGATATCACAGATCGCCTCTCACTCGAGTGAGAGGCGATCTGTGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2773s1c1
Sequence:CCGGCCTCTGGTACTTCCTGAACAACTCGAGTTGTTCAGGAAGTACCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2442s1c1
Sequence:CCGGCCAACAAGAAAGTGAACCAGTCTCGAGACTGGTTCACTTTCTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2350s1c1
Sequence:CCGGGAAGCTCCTTGAGTACTGCAACTCGAGTTGCAGTACTCAAGGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177087
FAM179A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 179, member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.4-1029s1c1
Sequence:CCGGGAGAAGATGCACAAGTCTTTACTCGAGTAAAGACTTGTGCATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2681s1c1
Sequence:CCGGGCAGTGCTGGATATCACAGATCTCGAGATCTGTGATATCCAGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177087.2-2977s1c1
Sequence:CCGGCAAGGTCATAGGTGGAAGAATCTCGAGATTCTTCCACCTATGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2690s1c1
Sequence:CCGGGATATCACAGATCGCCTCTCACTCGAGTGAGAGGCGATCTGTGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2773s1c1
Sequence:CCGGCCTCTGGTACTTCCTGAACAACTCGAGTTGTTCAGGAAGTACCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2442s1c1
Sequence:CCGGCCAACAAGAAAGTGAACCAGTCTCGAGACTGGTTCACTTTCTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177087.2-2350s1c1
Sequence:CCGGGAAGCTCCTTGAGTACTGCAACTCGAGTTGCAGTACTCAAGGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199280
FAM179A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 179, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-663s1c1
Sequence:CCGGCCTGGCAGATTTCTGTTCTCTCTCGAGAGAGAACAGAAATCTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-709s1c1
Sequence:CCGGCCAGTTATCTTAGACCTGAAACTCGAGTTTCAGGTCTAAGATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-48s1c1
Sequence:CCGGGATAATGATGAACTTCCCTCTCTCGAGAGAGGGAAGTTCATCATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199280.1-1561s1c1
Sequence:CCGGGCAGGTTACTTATCTTGGTTTCTCGAGAAACCAAGATAAGTAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-351s1c1
Sequence:CCGGCTTCAGGATTCCAACAAGAAACTCGAGTTTCTTGTTGGAATCCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-695s1c1
Sequence:CCGGGTTGAACCATTCACCCAGTTACTCGAGTAACTGGGTGAATGGTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-476s1c1
Sequence:CCGGCAACTCCAAGAACTCAGGGATCTCGAGATCCCTGAGTTCTTGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-443s1c1
Sequence:CCGGGCTCTCCATCATCATCACTGTCTCGAGACAGTGATGATGATGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-2495s1c1
Sequence:CCGGCCATTGCTCAAAGTCAGCATTCTCGAGAATGCTGACTTTGAGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199280
FAM179A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 179, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-663s1c1
Sequence:CCGGCCTGGCAGATTTCTGTTCTCTCTCGAGAGAGAACAGAAATCTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-709s1c1
Sequence:CCGGCCAGTTATCTTAGACCTGAAACTCGAGTTTCAGGTCTAAGATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-48s1c1
Sequence:CCGGGATAATGATGAACTTCCCTCTCTCGAGAGAGGGAAGTTCATCATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199280.1-1561s1c1
Sequence:CCGGGCAGGTTACTTATCTTGGTTTCTCGAGAAACCAAGATAAGTAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-351s1c1
Sequence:CCGGCTTCAGGATTCCAACAAGAAACTCGAGTTTCTTGTTGGAATCCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-695s1c1
Sequence:CCGGGTTGAACCATTCACCCAGTTACTCGAGTAACTGGGTGAATGGTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-476s1c1
Sequence:CCGGCAACTCCAAGAACTCAGGGATCTCGAGATCCCTGAGTTCTTGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-443s1c1
Sequence:CCGGGCTCTCCATCATCATCACTGTCTCGAGACAGTGATGATGATGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-2495s1c1
Sequence:CCGGCCATTGCTCAAAGTCAGCATTCTCGAGAATGCTGACTTTGAGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199280
FAM179A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 179, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-663s1c1
Sequence:CCGGCCTGGCAGATTTCTGTTCTCTCTCGAGAGAGAACAGAAATCTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-709s1c1
Sequence:CCGGCCAGTTATCTTAGACCTGAAACTCGAGTTTCAGGTCTAAGATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-48s1c1
Sequence:CCGGGATAATGATGAACTTCCCTCTCTCGAGAGAGGGAAGTTCATCATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199280.1-1561s1c1
Sequence:CCGGGCAGGTTACTTATCTTGGTTTCTCGAGAAACCAAGATAAGTAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199280.1-351s1c1
Sequence:CCGGCTTCAGGATTCCAACAAGAAACTCGAGTTTCTTGTTGGAATCCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-695s1c1
Sequence:CCGGGTTGAACCATTCACCCAGTTACTCGAGTAACTGGGTGAATGGTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-476s1c1
Sequence:CCGGCAACTCCAAGAACTCAGGGATCTCGAGATCCCTGAGTTCTTGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-443s1c1
Sequence:CCGGGCTCTCCATCATCATCACTGTCTCGAGACAGTGATGATGATGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199280.1-2495s1c1
Sequence:CCGGCCATTGCTCAAAGTCAGCATTCTCGAGAATGCTGACTTTGAGCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)